ID: 1150853871

View in Genome Browser
Species Human (GRCh38)
Location 17:68732112-68732134
Sequence CCTTCTTGTTCTACTGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150853871_1150853878 2 Left 1150853871 17:68732112-68732134 CCTAGGCCAGTAGAACAAGAAGG No data
Right 1150853878 17:68732137-68732159 AGGGCACAGTGAAGGACAGAGGG No data
1150853871_1150853880 24 Left 1150853871 17:68732112-68732134 CCTAGGCCAGTAGAACAAGAAGG No data
Right 1150853880 17:68732159-68732181 GTTATCAGGAGCAAAGCAGATGG No data
1150853871_1150853876 -6 Left 1150853871 17:68732112-68732134 CCTAGGCCAGTAGAACAAGAAGG No data
Right 1150853876 17:68732129-68732151 AGAAGGCAAGGGCACAGTGAAGG No data
1150853871_1150853877 1 Left 1150853871 17:68732112-68732134 CCTAGGCCAGTAGAACAAGAAGG No data
Right 1150853877 17:68732136-68732158 AAGGGCACAGTGAAGGACAGAGG No data
1150853871_1150853879 10 Left 1150853871 17:68732112-68732134 CCTAGGCCAGTAGAACAAGAAGG No data
Right 1150853879 17:68732145-68732167 GTGAAGGACAGAGGGTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150853871 Original CRISPR CCTTCTTGTTCTACTGGCCT AGG (reversed) Intergenic
No off target data available for this crispr