ID: 1150853874

View in Genome Browser
Species Human (GRCh38)
Location 17:68732118-68732140
Sequence CCCTTGCCTTCTTGTTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150853874_1150853880 18 Left 1150853874 17:68732118-68732140 CCAGTAGAACAAGAAGGCAAGGG No data
Right 1150853880 17:68732159-68732181 GTTATCAGGAGCAAAGCAGATGG No data
1150853874_1150853877 -5 Left 1150853874 17:68732118-68732140 CCAGTAGAACAAGAAGGCAAGGG No data
Right 1150853877 17:68732136-68732158 AAGGGCACAGTGAAGGACAGAGG No data
1150853874_1150853878 -4 Left 1150853874 17:68732118-68732140 CCAGTAGAACAAGAAGGCAAGGG No data
Right 1150853878 17:68732137-68732159 AGGGCACAGTGAAGGACAGAGGG No data
1150853874_1150853879 4 Left 1150853874 17:68732118-68732140 CCAGTAGAACAAGAAGGCAAGGG No data
Right 1150853879 17:68732145-68732167 GTGAAGGACAGAGGGTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150853874 Original CRISPR CCCTTGCCTTCTTGTTCTAC TGG (reversed) Intergenic
No off target data available for this crispr