ID: 1150853880

View in Genome Browser
Species Human (GRCh38)
Location 17:68732159-68732181
Sequence GTTATCAGGAGCAAAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150853874_1150853880 18 Left 1150853874 17:68732118-68732140 CCAGTAGAACAAGAAGGCAAGGG No data
Right 1150853880 17:68732159-68732181 GTTATCAGGAGCAAAGCAGATGG No data
1150853871_1150853880 24 Left 1150853871 17:68732112-68732134 CCTAGGCCAGTAGAACAAGAAGG No data
Right 1150853880 17:68732159-68732181 GTTATCAGGAGCAAAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150853880 Original CRISPR GTTATCAGGAGCAAAGCAGA TGG Intergenic
No off target data available for this crispr