ID: 1150854190

View in Genome Browser
Species Human (GRCh38)
Location 17:68734804-68734826
Sequence TCAAGGGGGTTGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150854190_1150854200 5 Left 1150854190 17:68734804-68734826 CCCTCTGCCCTCAACCCCCTTGA No data
Right 1150854200 17:68734832-68734854 GCCTCTCTCAGTGTAAACATGGG No data
1150854190_1150854204 29 Left 1150854190 17:68734804-68734826 CCCTCTGCCCTCAACCCCCTTGA No data
Right 1150854204 17:68734856-68734878 TCCAAAAAGCATAGGGCACAAGG No data
1150854190_1150854203 22 Left 1150854190 17:68734804-68734826 CCCTCTGCCCTCAACCCCCTTGA No data
Right 1150854203 17:68734849-68734871 CATGGGATCCAAAAAGCATAGGG No data
1150854190_1150854202 21 Left 1150854190 17:68734804-68734826 CCCTCTGCCCTCAACCCCCTTGA No data
Right 1150854202 17:68734848-68734870 ACATGGGATCCAAAAAGCATAGG No data
1150854190_1150854199 4 Left 1150854190 17:68734804-68734826 CCCTCTGCCCTCAACCCCCTTGA No data
Right 1150854199 17:68734831-68734853 TGCCTCTCTCAGTGTAAACATGG No data
1150854190_1150854206 30 Left 1150854190 17:68734804-68734826 CCCTCTGCCCTCAACCCCCTTGA No data
Right 1150854206 17:68734857-68734879 CCAAAAAGCATAGGGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150854190 Original CRISPR TCAAGGGGGTTGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr