ID: 1150855560

View in Genome Browser
Species Human (GRCh38)
Location 17:68749042-68749064
Sequence GCACCGCATGTTCTCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150855560_1150855565 17 Left 1150855560 17:68749042-68749064 CCCACTGTGAGAACATGCGGTGC No data
Right 1150855565 17:68749082-68749104 CGTTAGTTTGCTGAGGATAAAGG 0: 143
1: 1641
2: 4620
3: 13254
4: 15087
1150855560_1150855563 10 Left 1150855560 17:68749042-68749064 CCCACTGTGAGAACATGCGGTGC No data
Right 1150855563 17:68749075-68749097 GTTCCTGCGTTAGTTTGCTGAGG 0: 129
1: 2458
2: 4210
3: 4190
4: 3574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150855560 Original CRISPR GCACCGCATGTTCTCACAGT GGG (reversed) Intergenic
No off target data available for this crispr