ID: 1150858509

View in Genome Browser
Species Human (GRCh38)
Location 17:68776579-68776601
Sequence GTGCCTCTCTTAACAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150858509_1150858514 10 Left 1150858509 17:68776579-68776601 CCTGCTCTTGTTAAGAGAGGCAC No data
Right 1150858514 17:68776612-68776634 AGGAGGTTTCAGGGCCTGCCAGG No data
1150858509_1150858511 -7 Left 1150858509 17:68776579-68776601 CCTGCTCTTGTTAAGAGAGGCAC No data
Right 1150858511 17:68776595-68776617 GAGGCACTGTTTAGAGAAGGAGG No data
1150858509_1150858513 1 Left 1150858509 17:68776579-68776601 CCTGCTCTTGTTAAGAGAGGCAC No data
Right 1150858513 17:68776603-68776625 GTTTAGAGAAGGAGGTTTCAGGG No data
1150858509_1150858515 11 Left 1150858509 17:68776579-68776601 CCTGCTCTTGTTAAGAGAGGCAC No data
Right 1150858515 17:68776613-68776635 GGAGGTTTCAGGGCCTGCCAGGG No data
1150858509_1150858510 -10 Left 1150858509 17:68776579-68776601 CCTGCTCTTGTTAAGAGAGGCAC No data
Right 1150858510 17:68776592-68776614 AGAGAGGCACTGTTTAGAGAAGG No data
1150858509_1150858512 0 Left 1150858509 17:68776579-68776601 CCTGCTCTTGTTAAGAGAGGCAC No data
Right 1150858512 17:68776602-68776624 TGTTTAGAGAAGGAGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150858509 Original CRISPR GTGCCTCTCTTAACAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr