ID: 1150859898

View in Genome Browser
Species Human (GRCh38)
Location 17:68790573-68790595
Sequence GCTAATGGCAGAAACTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150859888_1150859898 27 Left 1150859888 17:68790523-68790545 CCTTAGGATGAGGGGTTGCCAGT No data
Right 1150859898 17:68790573-68790595 GCTAATGGCAGAAACTGGGCTGG No data
1150859892_1150859898 9 Left 1150859892 17:68790541-68790563 CCAGTAGCAAGAGGCCGTGGGAT No data
Right 1150859898 17:68790573-68790595 GCTAATGGCAGAAACTGGGCTGG No data
1150859894_1150859898 -5 Left 1150859894 17:68790555-68790577 CCGTGGGATGCACGGATTGCTAA No data
Right 1150859898 17:68790573-68790595 GCTAATGGCAGAAACTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150859898 Original CRISPR GCTAATGGCAGAAACTGGGC TGG Intergenic
No off target data available for this crispr