ID: 1150863575

View in Genome Browser
Species Human (GRCh38)
Location 17:68826018-68826040
Sequence GCCAGATTTCTCCACTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150863573_1150863575 4 Left 1150863573 17:68825991-68826013 CCCTGGTCACTTGGTTAAGGCGT No data
Right 1150863575 17:68826018-68826040 GCCAGATTTCTCCACTATAAAGG No data
1150863574_1150863575 3 Left 1150863574 17:68825992-68826014 CCTGGTCACTTGGTTAAGGCGTT No data
Right 1150863575 17:68826018-68826040 GCCAGATTTCTCCACTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150863575 Original CRISPR GCCAGATTTCTCCACTATAA AGG Intergenic