ID: 1150865504 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:68845145-68845167 |
| Sequence | GTTTTGGGGCTGAGACGATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 17401 | |||
| Summary | {0: 45, 1: 520, 2: 4124, 3: 8775, 4: 3937} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1150865504_1150865512 | 14 | Left | 1150865504 | 17:68845145-68845167 | CCCCATCGTCTCAGCCCCAAAAC | 0: 45 1: 520 2: 4124 3: 8775 4: 3937 |
||
| Right | 1150865512 | 17:68845182-68845204 | AGCAACTTCAGCAAGGTCTCAGG | 0: 33 1: 10954 2: 5335 3: 2333 4: 1821 |
||||
| 1150865504_1150865511 | 7 | Left | 1150865504 | 17:68845145-68845167 | CCCCATCGTCTCAGCCCCAAAAC | 0: 45 1: 520 2: 4124 3: 8775 4: 3937 |
||
| Right | 1150865511 | 17:68845175-68845197 | CCTGATAAGCAACTTCAGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1150865504 | Original CRISPR | GTTTTGGGGCTGAGACGATG GGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||