ID: 1150865504

View in Genome Browser
Species Human (GRCh38)
Location 17:68845145-68845167
Sequence GTTTTGGGGCTGAGACGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17401
Summary {0: 45, 1: 520, 2: 4124, 3: 8775, 4: 3937}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150865504_1150865512 14 Left 1150865504 17:68845145-68845167 CCCCATCGTCTCAGCCCCAAAAC 0: 45
1: 520
2: 4124
3: 8775
4: 3937
Right 1150865512 17:68845182-68845204 AGCAACTTCAGCAAGGTCTCAGG 0: 33
1: 10954
2: 5335
3: 2333
4: 1821
1150865504_1150865511 7 Left 1150865504 17:68845145-68845167 CCCCATCGTCTCAGCCCCAAAAC 0: 45
1: 520
2: 4124
3: 8775
4: 3937
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150865504 Original CRISPR GTTTTGGGGCTGAGACGATG GGG (reversed) Intergenic
Too many off-targets to display for this crispr