ID: 1150865505

View in Genome Browser
Species Human (GRCh38)
Location 17:68845146-68845168
Sequence AGTTTTGGGGCTGAGACGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17901
Summary {0: 49, 1: 546, 2: 4224, 3: 9108, 4: 3974}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150865505_1150865511 6 Left 1150865505 17:68845146-68845168 CCCATCGTCTCAGCCCCAAAACT 0: 49
1: 546
2: 4224
3: 9108
4: 3974
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data
1150865505_1150865512 13 Left 1150865505 17:68845146-68845168 CCCATCGTCTCAGCCCCAAAACT 0: 49
1: 546
2: 4224
3: 9108
4: 3974
Right 1150865512 17:68845182-68845204 AGCAACTTCAGCAAGGTCTCAGG 0: 33
1: 10954
2: 5335
3: 2333
4: 1821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150865505 Original CRISPR AGTTTTGGGGCTGAGACGAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr