ID: 1150865506

View in Genome Browser
Species Human (GRCh38)
Location 17:68845147-68845169
Sequence GAGTTTTGGGGCTGAGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17838
Summary {0: 50, 1: 511, 2: 4158, 3: 8916, 4: 4203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150865506_1150865511 5 Left 1150865506 17:68845147-68845169 CCATCGTCTCAGCCCCAAAACTC 0: 50
1: 511
2: 4158
3: 8916
4: 4203
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data
1150865506_1150865512 12 Left 1150865506 17:68845147-68845169 CCATCGTCTCAGCCCCAAAACTC 0: 50
1: 511
2: 4158
3: 8916
4: 4203
Right 1150865512 17:68845182-68845204 AGCAACTTCAGCAAGGTCTCAGG 0: 33
1: 10954
2: 5335
3: 2333
4: 1821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150865506 Original CRISPR GAGTTTTGGGGCTGAGACGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr