ID: 1150865507

View in Genome Browser
Species Human (GRCh38)
Location 17:68845159-68845181
Sequence TATCAGGTTAAAGAGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150865507_1150865512 0 Left 1150865507 17:68845159-68845181 CCCCAAAACTCTTTAACCTGATA No data
Right 1150865512 17:68845182-68845204 AGCAACTTCAGCAAGGTCTCAGG 0: 33
1: 10954
2: 5335
3: 2333
4: 1821
1150865507_1150865511 -7 Left 1150865507 17:68845159-68845181 CCCCAAAACTCTTTAACCTGATA No data
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150865507 Original CRISPR TATCAGGTTAAAGAGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr