ID: 1150865509

View in Genome Browser
Species Human (GRCh38)
Location 17:68845161-68845183
Sequence CTTATCAGGTTAAAGAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150865509_1150865511 -9 Left 1150865509 17:68845161-68845183 CCAAAACTCTTTAACCTGATAAG No data
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data
1150865509_1150865512 -2 Left 1150865509 17:68845161-68845183 CCAAAACTCTTTAACCTGATAAG No data
Right 1150865512 17:68845182-68845204 AGCAACTTCAGCAAGGTCTCAGG 0: 33
1: 10954
2: 5335
3: 2333
4: 1821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150865509 Original CRISPR CTTATCAGGTTAAAGAGTTT TGG (reversed) Intergenic
No off target data available for this crispr