ID: 1150865511

View in Genome Browser
Species Human (GRCh38)
Location 17:68845175-68845197
Sequence CCTGATAAGCAACTTCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150865506_1150865511 5 Left 1150865506 17:68845147-68845169 CCATCGTCTCAGCCCCAAAACTC 0: 50
1: 511
2: 4158
3: 8916
4: 4203
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data
1150865505_1150865511 6 Left 1150865505 17:68845146-68845168 CCCATCGTCTCAGCCCCAAAACT 0: 49
1: 546
2: 4224
3: 9108
4: 3974
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data
1150865508_1150865511 -8 Left 1150865508 17:68845160-68845182 CCCAAAACTCTTTAACCTGATAA No data
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data
1150865507_1150865511 -7 Left 1150865507 17:68845159-68845181 CCCCAAAACTCTTTAACCTGATA No data
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data
1150865504_1150865511 7 Left 1150865504 17:68845145-68845167 CCCCATCGTCTCAGCCCCAAAAC 0: 45
1: 520
2: 4124
3: 8775
4: 3937
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data
1150865509_1150865511 -9 Left 1150865509 17:68845161-68845183 CCAAAACTCTTTAACCTGATAAG No data
Right 1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150865511 Original CRISPR CCTGATAAGCAACTTCAGCA AGG Intergenic
No off target data available for this crispr