ID: 1150868866

View in Genome Browser
Species Human (GRCh38)
Location 17:68882177-68882199
Sequence CCTGAAAAAACTGCCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150868866_1150868871 24 Left 1150868866 17:68882177-68882199 CCTACAAAGGCAGTTTTTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 203
Right 1150868871 17:68882224-68882246 CTGTCCTTTCAGATCAAACGGGG 0: 1
1: 0
2: 0
3: 1
4: 68
1150868866_1150868868 22 Left 1150868866 17:68882177-68882199 CCTACAAAGGCAGTTTTTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 203
Right 1150868868 17:68882222-68882244 GCCTGTCCTTTCAGATCAAACGG 0: 1
1: 0
2: 0
3: 21
4: 129
1150868866_1150868872 25 Left 1150868866 17:68882177-68882199 CCTACAAAGGCAGTTTTTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 203
Right 1150868872 17:68882225-68882247 TGTCCTTTCAGATCAAACGGGGG 0: 1
1: 0
2: 0
3: 3
4: 79
1150868866_1150868870 23 Left 1150868866 17:68882177-68882199 CCTACAAAGGCAGTTTTTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 203
Right 1150868870 17:68882223-68882245 CCTGTCCTTTCAGATCAAACGGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150868866 Original CRISPR CCTGAAAAAACTGCCTTTGT AGG (reversed) Intronic
901150409 1:7097450-7097472 CCTGATAACACTGACTTTCTAGG - Intronic
901260856 1:7869514-7869536 CTTGAAAATGCTGCCTTTCTAGG + Intergenic
902369549 1:15997285-15997307 GCTGAAGACGCTGCCTTTGTGGG - Intergenic
903051271 1:20602950-20602972 CCTGAAACAACAGGCTGTGTGGG + Intronic
904505985 1:30954471-30954493 CATGAAAAAGCTGTCTTTGAAGG + Intronic
905517080 1:38569823-38569845 CCTGGAAAAGCTGCCTTTGTGGG - Intergenic
906737454 1:48144548-48144570 CCTGATAAGATTCCCTTTGTAGG - Intergenic
909412233 1:75367850-75367872 TGGGAAAAAAATGCCTTTGTGGG - Intronic
911020935 1:93387030-93387052 CTTGAAAAAACTGCATGTTTTGG + Intergenic
916777606 1:167983878-167983900 CCTGGAAAAGCTGCCTTTTAAGG - Intronic
918443344 1:184591325-184591347 CATGACAAAGCTGACTTTGTAGG + Intronic
918869362 1:189948818-189948840 CCTGTCAATACTGCCTTAGTGGG + Intergenic
918914269 1:190615285-190615307 CCTGAAAAAGCTCTCTTTTTTGG - Intergenic
920402843 1:205687511-205687533 CCTGAAGAAAGTGCCCTTGAAGG - Intergenic
921748539 1:218766064-218766086 CCTCGAAAAACTTCCATTGTGGG - Intergenic
1063819173 10:9814435-9814457 CCTGAAATAACTGCCCTGATAGG - Intergenic
1065022648 10:21513362-21513384 CCTGAAAGAAATGCATTTATTGG - Intergenic
1065092620 10:22250702-22250724 CCTTAAAAAATTTCCTTTCTTGG - Intergenic
1065624014 10:27612443-27612465 CTTGCAAACACAGCCTTTGTAGG - Intergenic
1065893065 10:30137515-30137537 CCTGAAAAATCTTCCTTTTAGGG + Intergenic
1067272808 10:44806637-44806659 TCAGAAAAAAGTGCCTTTGGAGG - Intergenic
1068426553 10:56872855-56872877 ACTGAATAAACTGACTTTGCAGG - Intergenic
1070268122 10:74924585-74924607 CCTGAAATAACTATCTTAGTTGG + Intronic
1071798457 10:89031076-89031098 CCTGAAAATACTGCCGGTGCTGG - Intergenic
1073843657 10:107527344-107527366 CCTGAAAAAGCTGCCCTTCAGGG + Intergenic
1075421822 10:122307216-122307238 TCTGAAAACAATGCTTTTGTGGG + Exonic
1075900581 10:126040006-126040028 CTTAAAAACACAGCCTTTGTGGG + Intronic
1075952597 10:126494776-126494798 CTTGAAATAAATGCCCTTGTAGG - Intronic
1076062604 10:127425428-127425450 CCTGAAAAATCTTCCTTTTTTGG - Intronic
1078622242 11:12919430-12919452 ACTGACAAAACCTCCTTTGTTGG + Intronic
1082021384 11:47536456-47536478 TTTTAAAAAACTGCATTTGTAGG + Intronic
1082312373 11:50667621-50667643 CTTGAAAAAGCTGTTTTTGTAGG - Intergenic
1082792160 11:57353664-57353686 GTTGAAAAATCTGCCTCTGTTGG - Intronic
1087253089 11:95924800-95924822 CCTTAAAAAACTTCCTTGCTAGG + Intronic
1088632873 11:111790878-111790900 ACTGCTAAAACTGCCTTTCTAGG - Intronic
1089732899 11:120530491-120530513 CCTGGAGAAGCTGCCTCTGTTGG - Intronic
1090983415 11:131744733-131744755 CCTGAATAAACTGGGTTTGAGGG - Intronic
1096644218 12:53020474-53020496 CCTGTAAAATATTCCTTTGTAGG - Intronic
1097516034 12:60607818-60607840 CCTGACAGCACTGCCTCTGTGGG + Intergenic
1099665071 12:85617975-85617997 CCTGGAATAACTGTTTTTGTGGG - Intergenic
1100017538 12:90029096-90029118 GCTGAAAAAATTGCTTTAGTGGG + Intergenic
1100330669 12:93578956-93578978 TCTGAAAAATCTGCCTCTGCTGG + Intronic
1104281617 12:127383142-127383164 CCAGCAATAACTGTCTTTGTTGG - Intergenic
1104379821 12:128297569-128297591 CCTGCAAAAGCTGGCTTTGAAGG + Intronic
1105414219 13:20194396-20194418 CCTGCAGAAACTGCCTAGGTCGG - Intergenic
1106683314 13:32030932-32030954 CTTGAAAAGACTGCATTTCTGGG + Intergenic
1110094443 13:71498791-71498813 CCTGAAGAAACTGTATTTTTAGG + Intronic
1111552890 13:89838852-89838874 CCAGAAAAAACTACATGTGTGGG + Intergenic
1113896694 13:113768992-113769014 CCTGGATAAAATGCCTTTGAGGG + Intronic
1115883887 14:37949994-37950016 CATGAAAAAACTGAGTTTGCAGG - Intronic
1116276163 14:42834965-42834987 CCAGAAAAAACTACATATGTTGG - Intergenic
1116955138 14:50915668-50915690 TTTCAAAAAGCTGCCTTTGTTGG + Intronic
1117027644 14:51637837-51637859 CTTGAAAAAACTGATTTAGTTGG - Intronic
1118169832 14:63377789-63377811 CCTGAAAAAATTGCACTTATAGG + Intronic
1121363788 14:93287902-93287924 CCTCGAAAAACTGCCTGTGTAGG - Intronic
1125119304 15:36134140-36134162 CCCAGAAAAACCGCCTTTGTAGG + Intergenic
1125775841 15:42212980-42213002 CATGGAAAAATTCCCTTTGTGGG + Intronic
1126317603 15:47386957-47386979 CCTGCAAACACTGTCATTGTGGG + Intronic
1126387158 15:48106056-48106078 CCTAGAAAAATTTCCTTTGTGGG + Intergenic
1129668035 15:77590398-77590420 CCTGGAAAATCTGGCTTTGGGGG - Intergenic
1130718592 15:86363193-86363215 GCAGACAAAAGTGCCTTTGTAGG - Intronic
1131088043 15:89594562-89594584 CCTTAAGAAACAGCCTTTCTAGG - Intronic
1131549850 15:93347981-93348003 CATGAGAAAGCTGCCCTTGTTGG + Intergenic
1135466176 16:22686838-22686860 CCTTAAAAAACAGCCTTTTGAGG + Intergenic
1138244874 16:55460055-55460077 GCTGAAAAAACGGCCTTGTTTGG + Intronic
1140622165 16:76747960-76747982 ACTTAAAAAACTGCTTTTTTTGG + Intergenic
1141960641 16:87405332-87405354 CCTGAGAAAACTGCCTTCCCAGG + Intergenic
1142533914 17:600142-600164 CCTGGCAAAACTGATTTTGTAGG + Intronic
1144110241 17:12023503-12023525 ACTCAAAAAACTTCCTTTCTGGG + Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149756678 17:59192021-59192043 CCTGTAAATACTGCCTTATTTGG + Intronic
1149773358 17:59338843-59338865 CCTGAAAATTCTGATTTTGTAGG - Intronic
1149938985 17:60842822-60842844 CCTAATAATACTGACTTTGTTGG + Intronic
1150868866 17:68882177-68882199 CCTGAAAAAACTGCCTTTGTAGG - Intronic
1153861728 18:9217488-9217510 GATTAAAAAGCTGCCTTTGTGGG + Intronic
1156104569 18:33643550-33643572 CCTAAAATAATTGTCTTTGTAGG + Intronic
1156647195 18:39179514-39179536 ACTGAAGAAAGTGCCTTTTTGGG + Intergenic
1156767201 18:40671502-40671524 ACTAAAAAATCTGCCTTTATTGG - Intergenic
1156920194 18:42512887-42512909 CCTGGAAATACTGCCTATGATGG + Intergenic
1157094806 18:44678716-44678738 CCTGAAAAGACCCCCTTTGTAGG + Intergenic
1160216950 18:76940600-76940622 ACTGAAATAAATGCCTTTCTGGG - Intronic
1163911858 19:20202787-20202809 CCTGACAAAAATGCCTTTATTGG + Intergenic
1164457596 19:28421513-28421535 CCTGAAAATGCTGCTTTTGGAGG - Intergenic
1165357525 19:35313049-35313071 CCTGGAGAAACTGAATTTGTAGG + Intronic
1166391704 19:42412201-42412223 CCTGAACAAGCTGCCCTTGGTGG + Intronic
1166913568 19:46178448-46178470 CCATAAAAAAATGGCTTTGTAGG - Intergenic
1168373126 19:55852775-55852797 CCTGAAAATATTGTCCTTGTAGG + Intronic
925260755 2:2526504-2526526 CCTGGAAAACCTGTCTTTTTTGG + Intergenic
926800699 2:16657655-16657677 CCTAAAAGAACTGACTGTGTCGG - Intronic
926803166 2:16680281-16680303 TTTGAAAAAACTTCCTTTATTGG - Intergenic
930265259 2:49192098-49192120 GCTGAATAAACTTTCTTTGTGGG + Intergenic
935787350 2:106560978-106561000 CCCGGAAACACTGCCATTGTTGG - Intergenic
938230066 2:129650677-129650699 CCTGAAACACCTGCCTCTATGGG + Intergenic
939418217 2:141928952-141928974 CCTGATAAAAGTATCTTTGTAGG + Intronic
939921593 2:148121783-148121805 GCTGAAAAAACTACATTTCTAGG + Intronic
940531012 2:154875835-154875857 ACTGAAAAAATGCCCTTTGTTGG - Intergenic
940683415 2:156815833-156815855 TCTGGAAAAACTGCCTATGTGGG + Intergenic
941210400 2:162630573-162630595 CCTGAAACAACTATCTTTTTAGG - Intronic
941787658 2:169516107-169516129 CCTGAAAAATCTGCCTGATTTGG + Intronic
943273050 2:185831861-185831883 CCTGAAATGACTTCCTTTGAGGG - Exonic
945968734 2:216216280-216216302 CCTGGAGAAAATGCATTTGTGGG - Intergenic
947718429 2:232353110-232353132 CCTGCACAGACTGCCTTTATTGG + Intergenic
948029074 2:234801521-234801543 CATGAAAAAATTGCTTGTGTAGG + Intergenic
948329203 2:237151647-237151669 CCTGAAAATACTCCCTTCGCTGG + Intergenic
948798403 2:240418866-240418888 CCTGATAGGACTGTCTTTGTTGG + Intergenic
948942315 2:241202724-241202746 CCTGAGAAAACAGCCACTGTGGG + Intronic
1169073645 20:2749147-2749169 CCTGAAAAAACTGGCTCCTTAGG - Intronic
1169391110 20:5192011-5192033 CCTGAAAACACTTCCTGTTTGGG - Exonic
1172002862 20:31794070-31794092 ACAGAAAAAACTGTCTTTGAGGG - Intronic
1172289978 20:33769325-33769347 CCTGAGAAATCTGACTTAGTGGG - Intronic
1173068463 20:39737285-39737307 CCTGAAAAAACAGCCTTGCATGG - Intergenic
1173438159 20:43050943-43050965 CTTCAAAAAACTGCCTTGGGAGG - Intronic
1175249310 20:57599187-57599209 CCTGAAAAAGCTGAGTCTGTGGG + Intergenic
1178575552 21:33785801-33785823 CATGGAAAAACAGCCTTTTTTGG - Intronic
1178881688 21:36455038-36455060 GATGCAAAAACTGCCTTTGGGGG + Intergenic
1183274184 22:36881405-36881427 ACTAAAAAAATTGCCTTTGAGGG + Intergenic
949359496 3:3216524-3216546 ACTGGAAAAACTGGCTTTGTTGG + Intergenic
953891777 3:46756405-46756427 CCTGAGAAAACTGCCTTCCAAGG + Exonic
955299526 3:57763909-57763931 GCTGAGGAAACTGACTTTGTTGG + Intronic
955319065 3:57961273-57961295 GCTCAAAAACCTGCCTTGGTCGG - Intergenic
956543674 3:70374571-70374593 ACTGATAATACTGCCTTGGTTGG + Intergenic
957307462 3:78476326-78476348 CCTGAAAAGTCTTCTTTTGTGGG - Intergenic
957801441 3:85088446-85088468 CCTGAAAAAACTACCTTTTGGGG + Intronic
958005126 3:87800783-87800805 CCTCAAAAAATTGTCTTTCTTGG + Intergenic
958028512 3:88077582-88077604 CATGAAAAACTTGCATTTGTGGG + Intronic
958645270 3:96863367-96863389 CCTGAAAAACCTGAATTTGTGGG + Intronic
959813130 3:110642834-110642856 CCTGACAAGACTAACTTTGTGGG - Intergenic
959851236 3:111089709-111089731 CTTGAAAAAATTGCCTTTGTTGG + Intronic
961022445 3:123520028-123520050 CCTGATAAGTTTGCCTTTGTTGG - Intronic
961073027 3:123954019-123954041 CCTGACTTAACTGCCTCTGTCGG - Intronic
962832018 3:139151338-139151360 CCTGATGAAATTCCCTTTGTAGG - Intronic
964231817 3:154479031-154479053 TATGAAAAAAATGACTTTGTCGG + Intergenic
965327962 3:167331233-167331255 CAGAAAATAACTGCCTTTGTTGG + Intronic
966476703 3:180357153-180357175 CCTAAAAAAGCAGACTTTGTTGG + Intergenic
969783606 4:9433376-9433398 CCTGGATAAAATGTCTTTGTGGG + Intergenic
971731307 4:30385290-30385312 CCTCAAATAACTGCATTGGTTGG + Intergenic
971901227 4:32660730-32660752 CTTGAAAAAATTGTTTTTGTTGG + Intergenic
974553611 4:63413672-63413694 CCTGAAATGTCTGCCTTTTTTGG - Intergenic
974721406 4:65743631-65743653 TTTGAAAAAATTGCCTTTGTTGG - Intergenic
975922191 4:79405679-79405701 CTTTTAAATACTGCCTTTGTAGG + Intergenic
975924008 4:79427084-79427106 CCTGAAGAAACTGCCACTTTTGG + Intergenic
978369542 4:108016559-108016581 CTTGACAAAACTCCCTTTTTTGG - Intronic
980433856 4:132742981-132743003 CCTTTAAAAACTGCCCTTGTTGG - Intergenic
981715417 4:147747078-147747100 CCTGAAACAGCGGCCTTTCTGGG - Intronic
982465830 4:155730434-155730456 CCTTAAAAAGCTACTTTTGTGGG + Exonic
982707290 4:158723917-158723939 CCTGATAAAACTGTATTTGGCGG + Intergenic
983902405 4:173149665-173149687 CCTAAAAACACTGCTTTTCTAGG - Intergenic
984859274 4:184221731-184221753 TCTGAAGAAATTGCCTTTCTGGG + Intergenic
986286186 5:6360785-6360807 CCTGTAGAAACTTACTTTGTAGG - Intergenic
986738253 5:10683149-10683171 CCTGAAGAAAGTGCCAGTGTTGG - Intronic
989836077 5:45993493-45993515 TTTGAAAAAACTGTATTTGTAGG + Intergenic
989838475 5:46027879-46027901 TTTGGAAACACTGCCTTTGTAGG + Intergenic
990673335 5:58157105-58157127 GCTGCAAAACCTGCCTCTGTGGG + Intergenic
991513886 5:67412356-67412378 CCTTTAAAACCTGCCTCTGTTGG + Intergenic
992723190 5:79580657-79580679 CCTGGGGACACTGCCTTTGTAGG + Intergenic
995537207 5:113148998-113149020 TCTGTAAAAGCTGTCTTTGTAGG + Intronic
996163529 5:120196679-120196701 CATAAAATAACAGCCTTTGTAGG + Intergenic
997485128 5:134225302-134225324 CCTAACAAGACTGCCTTTGGGGG + Intronic
999347838 5:150840198-150840220 CTTGGAAATACTGGCTTTGTTGG - Intergenic
999566129 5:152863947-152863969 CCTGAAATAATTTCCCTTGTTGG + Intergenic
1001512958 5:172336613-172336635 CCCCAAAAAACTGGCTTTGTGGG + Exonic
1005092559 6:22073066-22073088 CCTCAAAATGCTGGCTTTGTTGG - Intergenic
1006042669 6:31269151-31269173 CCTGAGACAGCTGCCTGTGTGGG - Exonic
1007265581 6:40593343-40593365 TCTAATAAAACTGCCTTTGTGGG + Intergenic
1009055858 6:58334237-58334259 CCTGAAAGAACAGCATATGTGGG + Intergenic
1014078194 6:117261908-117261930 CATGAAAAAAATGAGTTTGTGGG + Intergenic
1014968593 6:127787035-127787057 CCTGAAAAAGCACCCTTTCTAGG + Intronic
1015416842 6:132958859-132958881 CCTGAAAAGAAAGCCTTTGCCGG - Intergenic
1017472871 6:154757610-154757632 CATGAAAAAAATACCTTTATTGG + Intronic
1018297607 6:162366120-162366142 CATTATAAAACTGCATTTGTGGG - Intronic
1022527922 7:31050306-31050328 CTAGAAAAAACTGCCCTTTTTGG + Intergenic
1022787745 7:33655310-33655332 CCTGTACAAACGGCCTTTCTGGG - Intergenic
1022968185 7:35493681-35493703 CCTAAAAGAACTGCTTTTGGGGG + Intergenic
1023366115 7:39464974-39464996 CATTAAAAAACTGGCTTTGGGGG - Intronic
1023536418 7:41217372-41217394 CCTGTAAAATCTGGCTTAGTTGG - Intergenic
1024088050 7:45913174-45913196 CCCGAAATACCTGCCTTTATAGG + Intronic
1024430010 7:49277291-49277313 CCTGAAAAAAATATTTTTGTGGG - Intergenic
1024479685 7:49851048-49851070 CCAGAAGAAACTGACTCTGTGGG - Intronic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1027762491 7:82297370-82297392 CCTGTTAATACTTCCTTTGTGGG + Intronic
1029945916 7:104532671-104532693 CCTGCAAAAACTTCCCTTCTTGG - Intronic
1031039590 7:116825494-116825516 CCTGATGAAATTTCCTTTGTAGG + Intronic
1031336118 7:120534596-120534618 ACTGAAAAAACACCCTTGGTGGG - Intronic
1031343571 7:120636217-120636239 CCTAAAAAAACTCAGTTTGTGGG + Intronic
1033809520 7:144994775-144994797 TCTGAAAACATTGACTTTGTAGG + Intergenic
1035869719 8:3124492-3124514 GCTGAAAAGCCTGCCTTTCTTGG - Intronic
1038705103 8:29886169-29886191 CCTGGAGAATCTGCCTATGTTGG - Intergenic
1039948232 8:42148171-42148193 TCTGAAAAAAATGTCTTTCTGGG + Intergenic
1040589950 8:48782445-48782467 CCTGTAAGGACTGCCTCTGTGGG + Intergenic
1042345020 8:67718498-67718520 AATGAAAAAAATGCCTGTGTGGG - Intronic
1045862683 8:106830931-106830953 CCTGAGAAAACTGCTTTTTCTGG - Intergenic
1046170126 8:110494977-110494999 CCTGAAACATCTGCCTTTTAAGG + Intergenic
1046678131 8:117135090-117135112 CCTACAAAAACTGCTTTTCTAGG - Intronic
1048460343 8:134616092-134616114 CATGAAACACCTGCTTTTGTAGG - Intronic
1049710028 8:144059285-144059307 CCGGAAGAAGCTGCCTTCGTGGG - Intronic
1050206804 9:3204931-3204953 CCTGAACAAACAGGCTTTGCTGG + Intergenic
1050662646 9:7899825-7899847 CCCGAAAAAGTTACCTTTGTCGG + Intergenic
1050711116 9:8464997-8465019 TCTGAAAATACTGACTTTGGGGG - Intronic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1052925876 9:34015963-34015985 CTTTAAAAAGCTGCCTTTGCTGG - Intronic
1055237255 9:74138580-74138602 GACGAAAAAACTGACTTTGTTGG + Intergenic
1055748034 9:79472368-79472390 CCTGAAGAAACTGCTTCTGTGGG - Intergenic
1058624005 9:106915248-106915270 GCTGAAAAACCTAACTTTGTTGG + Intronic
1061260962 9:129480949-129480971 CCTGAACTAACTGCCTCAGTAGG - Intergenic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1188828999 X:34873173-34873195 CCTGATAAAACTGTATTTTTGGG - Intergenic
1189244941 X:39556083-39556105 ACTGAAAAAGGTGACTTTGTGGG + Intergenic
1190097449 X:47493038-47493060 CCTGAAAATACTGCCATTAGAGG + Intergenic
1191915693 X:66199106-66199128 CCTGAAAACACTGATTTTATTGG + Intronic
1192368380 X:70494046-70494068 CCTGGGAAAACTGGCTCTGTAGG - Intronic
1193061332 X:77211274-77211296 CCTGATAGAAATCCCTTTGTAGG + Intergenic
1193240805 X:79166865-79166887 CATGAAAACACTGTCTTTGCTGG + Intergenic
1195313557 X:103656628-103656650 AGTCAAAAAACTGCCATTGTGGG + Intergenic
1195624676 X:106995750-106995772 TCTGATAAAGCTGCCATTGTAGG - Intronic
1196238824 X:113316462-113316484 CATGAGAAAATTCCCTTTGTGGG + Intergenic
1196899039 X:120365416-120365438 GCTAAAAATGCTGCCTTTGTTGG - Intronic
1196963557 X:121030429-121030451 GGTGACTAAACTGCCTTTGTAGG - Intergenic
1200384143 X:155872441-155872463 CCTCAAAAATGTGACTTTGTAGG + Intergenic
1201398965 Y:13582040-13582062 CATGAAAAAACTGGCTATGGTGG + Intergenic