ID: 1150869614

View in Genome Browser
Species Human (GRCh38)
Location 17:68892107-68892129
Sequence GAGTAACAACAGATGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150869614_1150869617 -1 Left 1150869614 17:68892107-68892129 CCTAGTTCCATCTGTTGTTACTC 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1150869617 17:68892129-68892151 CCTGTTTGTAAAAATCTTTAAGG 0: 1
1: 0
2: 1
3: 24
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150869614 Original CRISPR GAGTAACAACAGATGGAACT AGG (reversed) Intronic
902136247 1:14308450-14308472 AAGTAAAAACAGGTGGATCTGGG + Intergenic
903897728 1:26620068-26620090 GGCTACCAACAGAAGGAACTCGG - Intergenic
907561872 1:55398468-55398490 GAGGAGCAAGAGAGGGAACTTGG + Intergenic
908828937 1:68160479-68160501 TAGTAACAAGAGTTGGAAATTGG + Intronic
918335512 1:183507349-183507371 TAGTAACAACCCATAGAACTGGG - Intronic
922509097 1:226148271-226148293 TGCTAACAACAGAGGGAACTTGG + Intronic
924595007 1:245437280-245437302 GAGGAACAAAGGATGGAACACGG - Intronic
1064649995 10:17499410-17499432 GAAGAACAACTGATGGTACTAGG + Intergenic
1065775991 10:29120822-29120844 AATTAACAACAAATGGTACTTGG - Intergenic
1068121626 10:52786705-52786727 GAGTAAGAAGAGATGGACCCTGG + Intergenic
1069299686 10:66890592-66890614 GAGTAAAAAGAGATTGAAGTGGG + Intronic
1069429523 10:68321785-68321807 GAGTAACAAAAGAAGCAACACGG + Intronic
1070931311 10:80262860-80262882 TTGTAACAGGAGATGGAACTTGG - Intergenic
1072359407 10:94644798-94644820 GAGTAACAAGGGTTGGAAATTGG + Intergenic
1074186390 10:111102582-111102604 GATTAGGAACAGAAGGAACTGGG - Intergenic
1075775971 10:124988229-124988251 TAGTAACAAGAGCTGGAAATTGG + Intronic
1079456570 11:20641658-20641680 GAGTACCAGAAAATGGAACTAGG - Intronic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1082913880 11:58409801-58409823 AAGCAACAACAAATGAAACTGGG + Intergenic
1083538019 11:63490072-63490094 GGGTGATAACAGATGGTACTGGG - Intronic
1085054985 11:73398234-73398256 GAGTGACACCTGATGGAACCTGG + Intergenic
1085661525 11:78371873-78371895 TTGTAATAAGAGATGGAACTGGG - Intronic
1092394952 12:8117636-8117658 TAGTATTAACAGATGGGACTTGG - Intergenic
1093623202 12:21316605-21316627 GAGAAACAAGAGGGGGAACTAGG - Intronic
1094663886 12:32499063-32499085 GAGTAACGGCAAATGGAATTAGG + Intronic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1095104952 12:38222087-38222109 GAGTGATAACAGATGGATCCGGG + Intergenic
1095743776 12:45634976-45634998 CACTAACAACAAATGGAAATAGG - Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1096763130 12:53860283-53860305 GAGAAACAAGAGGTGGAACAAGG + Intergenic
1097132588 12:56823565-56823587 GTGGAAAAGCAGATGGAACTTGG - Intergenic
1097749484 12:63336516-63336538 GAGTAAGAACATATGGTATTTGG - Intergenic
1105265064 13:18808501-18808523 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1109268757 13:60230664-60230686 GAGAAACTAAAGATGAAACTGGG + Intergenic
1110490755 13:76102968-76102990 GAGAAACAACTGAAGAAACTAGG - Intergenic
1111537778 13:89626590-89626612 GAGTCACAACAGGAGGAACCAGG + Intergenic
1113419464 13:110159252-110159274 GAGCAAAAACTGGTGGAACTGGG + Intronic
1114881263 14:26788937-26788959 GAGAAACAACAGATATAACTTGG + Intergenic
1114942243 14:27627528-27627550 TTGTAACAAAAGATGGAACATGG - Intergenic
1115795604 14:36931753-36931775 GAGTTAGAATAGATGGGACTTGG + Intronic
1119682219 14:76601325-76601347 GAGTAACAACATATTGTTCTGGG + Intergenic
1119715312 14:76854858-76854880 GAGTAACGACAGCTGGCTCTTGG - Intronic
1119901598 14:78265005-78265027 GAGAAACAACAGTGTGAACTTGG - Intronic
1120014373 14:79453779-79453801 GAGTAAAAAAAGAAGGATCTGGG - Intronic
1120430323 14:84404938-84404960 GAATCACAACAGATGAAACACGG + Intergenic
1121158687 14:91713337-91713359 GAGTGACAACTGATGAAATTAGG + Intronic
1121705418 14:95989662-95989684 GAGGAACAACAGAGGGTAATTGG - Intergenic
1202833407 14_GL000009v2_random:59614-59636 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1202906407 14_GL000194v1_random:76084-76106 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1123510022 15:20989019-20989041 GAGTAACAGTAGAAGGAATTGGG + Intergenic
1123552741 15:21398491-21398513 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123552956 15:21399771-21399793 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123553269 15:21401681-21401703 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123567239 15:21562764-21562786 GAGTAACAGTAGAAGGAATTGGG + Intergenic
1123588987 15:21835879-21835901 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123589089 15:21836520-21836542 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123589202 15:21837159-21837181 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123589515 15:21839069-21839091 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123603501 15:22000057-22000079 GAGTAACAGTAGAAGGAATTGGG + Intergenic
1123784114 15:23651692-23651714 GACTAACAATAGATGTAAATAGG - Intergenic
1124694817 15:31855681-31855703 GAGTAACAAAATAGGGAAATGGG + Intronic
1125187423 15:36947467-36947489 TAGTAACAAGCGATGGAACATGG - Intronic
1125881210 15:43197685-43197707 AAGGAACAACAGATGTAGCTTGG - Intronic
1126064836 15:44818810-44818832 GAATCACAACAGCTGAAACTGGG - Intergenic
1126355656 15:47793098-47793120 GAATAAGAACTGAAGGAACTAGG - Intergenic
1127519970 15:59734133-59734155 GATGAAGAACAGATGGAATTGGG + Intergenic
1127715174 15:61642891-61642913 GAGTAACAACAGAAGGCAGAAGG + Intergenic
1127892313 15:63264859-63264881 GAACCAAAACAGATGGAACTGGG - Exonic
1128817733 15:70626385-70626407 CAGCAACAATGGATGGAACTGGG + Intergenic
1129797022 15:78385442-78385464 GAGTAACATCAGTTGGCTCTGGG - Intergenic
1130155250 15:81344873-81344895 GAGAAACAACACATGGGCCTTGG - Exonic
1202961091 15_KI270727v1_random:125711-125733 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1202961192 15_KI270727v1_random:126352-126374 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1202961305 15_KI270727v1_random:126991-127013 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1202961618 15_KI270727v1_random:128901-128923 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1202975603 15_KI270727v1_random:289858-289880 GAGTAACAGTAGAAGGAATTGGG + Intergenic
1136926939 16:34382981-34383003 TAGTAATAAGCGATGGAACTGGG + Intergenic
1136977635 16:35028826-35028848 TAGTAATAAGCGATGGAACTGGG - Intergenic
1138114046 16:54346087-54346109 GAGTAACCACTGATGGATATGGG - Intergenic
1139200764 16:64974435-64974457 GATTTACAAAAGATGAAACTTGG + Intronic
1139910166 16:70392775-70392797 CAAAAACAACAGATGGCACTGGG - Intronic
1141560583 16:84865133-84865155 GAGGAACACCTGATGAAACTTGG + Intronic
1143427415 17:6851009-6851031 TGGGAACAACAGCTGGAACTAGG - Intergenic
1143978632 17:10848610-10848632 CAGTGACCACAGAAGGAACTTGG + Intergenic
1150869614 17:68892107-68892129 GAGTAACAACAGATGGAACTAGG - Intronic
1154453654 18:14501888-14501910 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1154453751 18:14502529-14502551 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1154453957 18:14503798-14503820 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1159258857 18:65984394-65984416 GAGTAACAATAAATTAAACTTGG - Intergenic
1160915203 19:1493097-1493119 GATTAGCAGCAGATGGGACTGGG - Intronic
1164467764 19:28502284-28502306 GAGCAGCAAGAGATGGAAATAGG + Intergenic
1167596924 19:50432759-50432781 GAGAAATAACAGCTGGACCTAGG - Intergenic
1202639265 1_KI270706v1_random:68081-68103 GAGGAAAAGCAGATGGCACTGGG - Intergenic
926669812 2:15565909-15565931 GAGTACCAACACGTGGAACTGGG + Intergenic
928239636 2:29575348-29575370 GAATAAAAACAGATGAAACCTGG - Intronic
929198174 2:39207799-39207821 GAGTAAAAACAATTGGAACCTGG + Intronic
929204657 2:39277206-39277228 TGGTAACAATAGATGGAGCTGGG - Intronic
933610089 2:84424971-84424993 GAGTAACAAGAAATGGAAATTGG - Intronic
934494723 2:94787540-94787562 GAGGAAAAGCAGATGGCACTGGG - Intergenic
935034519 2:99355998-99356020 TAGTAATAACAGAAGAAACTAGG - Intronic
938417088 2:131112578-131112600 GAGTAGCAACAGTTAGAAGTGGG + Intronic
940114338 2:150191872-150191894 GAGTAAGGAGAGATGGAAGTGGG + Intergenic
941482578 2:166035404-166035426 GAGGAACAAAAGATTTAACTCGG - Intronic
943604311 2:189958197-189958219 GAGCAACACCATAAGGAACTGGG + Intronic
944375811 2:199040690-199040712 AAGTAACAACATATGCAACGTGG + Intergenic
945433243 2:209790320-209790342 GAGTAATAACAGTTGGAAAGAGG - Intronic
946102381 2:217337135-217337157 GAGTAACAAGTGATGGAACCAGG + Intronic
947804024 2:232952194-232952216 GAGTAATATCAGTGGGAACTGGG + Intronic
947899917 2:233712718-233712740 GAGAAACAAGAGCTTGAACTTGG + Intronic
947902006 2:233728852-233728874 GAGAAACAAGAGCTTGAACTTGG + Intronic
947904066 2:233746939-233746961 GAGAAACAAGAGCTTGAACTTGG + Intronic
948339024 2:237234133-237234155 GAGTAACAACAGAGGCCTCTGGG - Intergenic
1169930348 20:10826095-10826117 GGGTGACAACAGATGAAACGTGG - Intergenic
1170487672 20:16835901-16835923 GAGTAAGAACATATGGTATTTGG + Intergenic
1170487919 20:16838642-16838664 GAGTAAGAACATATGGTATTTGG + Intergenic
1171885859 20:30652196-30652218 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1174843511 20:53921508-53921530 AAGCAACAACAGCTGGAGCTGGG + Intergenic
1176625752 21:9090883-9090905 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176647589 21:9365690-9365712 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1176820214 21:13649498-13649520 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176820317 21:13650137-13650159 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176820430 21:13650776-13650798 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176820528 21:13651417-13651439 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1180362684 22:11913783-11913805 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1181527160 22:23496546-23496568 AAGTACCCACATATGGAACTGGG - Intergenic
1182792658 22:32965992-32966014 GATTAAAAACAGATGGAATCTGG - Intronic
1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184887495 22:47355338-47355360 GAGTAGCCACAGATGGCATTTGG + Intergenic
949681193 3:6516397-6516419 GAGTAACAACAGATGGAAACAGG + Intergenic
950526609 3:13528235-13528257 GAGTAACCACAGAGAGAACCCGG + Intergenic
952131711 3:30371692-30371714 GAGTAACAACTGCTGAACCTGGG - Intergenic
955016254 3:55073063-55073085 GAGGAACATCAAATGTAACTTGG + Intronic
959152718 3:102626882-102626904 GAGTAACAAAACACTGAACTTGG + Intergenic
960199961 3:114821085-114821107 GAATAACAATGGATGGAACTTGG + Intronic
962112511 3:132468581-132468603 GATTAACAAGTGATGAAACTAGG - Intronic
966898579 3:184464242-184464264 TAGGAAGAACAGATGGACCTAGG - Intronic
967111892 3:186301237-186301259 GAGGACCAACAGATGGACATGGG - Intronic
968075306 3:195812884-195812906 GAGTTCCAAGAGGTGGAACTGGG - Intergenic
1202739289 3_GL000221v1_random:39297-39319 GAGGAAAAGCAGATGGCACTGGG + Intergenic
969451990 4:7279262-7279284 GAAAAACATCAGATGGAGCTAGG + Intronic
970480991 4:16474325-16474347 TTGTAACAAGAGATGAAACTTGG + Intergenic
971743833 4:30553090-30553112 TAGTAAGAACAGAAGGCACTAGG + Intergenic
972979744 4:44681904-44681926 GAGAAACAAAAGATGTAACATGG - Intronic
973369503 4:49234441-49234463 GAGGAAAAGCAGATGGCACTGGG - Intergenic
973391528 4:49560975-49560997 GAGGAAAAGCAGATGGCACTGGG + Intergenic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
976392276 4:84517855-84517877 GAGTAACAAGAGCTTGAATTAGG - Intergenic
977020698 4:91755593-91755615 GAGTATCAACAGATGAATTTGGG - Intergenic
978067071 4:104418264-104418286 GAGTTATGACAGATGGCACTAGG - Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
981243538 4:142507664-142507686 GAGTATCAGCAGCTTGAACTTGG + Intronic
981773012 4:148331808-148331830 CAGTAATAAGAGATGGTACTTGG - Intronic
982726709 4:158913951-158913973 AATTAACAACAGATGGGGCTGGG + Intronic
1202766615 4_GL000008v2_random:153951-153973 GAGGAAAAGCAGATGGCACTGGG - Intergenic
986054415 5:4121632-4121654 CAGCAATAACAGATGGAAGTTGG - Intergenic
987765936 5:22229750-22229772 GAGAAACTGCAGATGGAACATGG - Intronic
988104190 5:26722396-26722418 GAGTTAAAACAGATAGAAATAGG - Intergenic
988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG + Intergenic
996362197 5:122662086-122662108 TTGTAACAGCAGATGGAACATGG + Intergenic
997764402 5:136485754-136485776 GAGGAACAGCAGATGCAAATGGG - Intergenic
998449754 5:142225222-142225244 AAGTAAAAACAAATGTAACTGGG - Intergenic
998582082 5:143387088-143387110 GAGTAATAAGAGTTTGAACTAGG + Intronic
1001098628 5:168795939-168795961 GAGTAAAAAGAGATGGACCATGG + Intronic
1001423218 5:171602726-171602748 CTGTAACAAGAGATGGAACATGG - Intergenic
1005582226 6:27246255-27246277 GAGTGACAACAGAAGGATCAGGG + Intergenic
1008779514 6:55086130-55086152 AAGTAAGAACAGATGGTATTTGG - Intergenic
1011535553 6:88372263-88372285 GAGTAGAAAGAGATAGAACTGGG + Intergenic
1012633413 6:101502993-101503015 GAGGAATAACAGATGGAGGTGGG + Intronic
1013784464 6:113764334-113764356 CAGCAACAACAGATGGAAATGGG + Intergenic
1016589293 6:145726943-145726965 TATTAACAACAGAGGAAACTGGG + Intronic
1020612126 7:10411564-10411586 GTGTAACATCAGATGGAATTTGG + Intergenic
1022245589 7:28556223-28556245 GAGTCACAGAAGATGGAATTTGG - Intronic
1028091451 7:86708052-86708074 TACTAACAACAGATAGAACTGGG + Intronic
1028175541 7:87653722-87653744 GAGAAAGAAAAGAGGGAACTTGG - Intronic
1031016263 7:116579914-116579936 GAGTATCATCAGCGGGAACTAGG + Intergenic
1031638559 7:124132955-124132977 GACTAATAACAAATGAAACTAGG - Intergenic
1032351858 7:131171825-131171847 GACAAAGAACAGATAGAACTTGG + Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1035856665 8:2983102-2983124 TGAGAACAACAGATGGAACTTGG - Intronic
1044574680 8:93754982-93755004 GAGGAACAACAGAAGGAACGCGG - Exonic
1047458573 8:125039713-125039735 GAGTAAGAACTGAAGAAACTGGG + Intronic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1049069311 8:140344776-140344798 GAGAAACATCAGGTGGACCTGGG + Intronic
1049233937 8:141499480-141499502 AAATGACAACAGATGGAAATAGG + Intergenic
1052224171 9:26064425-26064447 AAGCAACAATAGATGAAACTTGG + Intergenic
1052523172 9:29577339-29577361 GTGGAACAAGAGATGGAACTAGG - Intergenic
1052877209 9:33575908-33575930 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1053498793 9:38568486-38568508 GAGGAAAAGCAGATGGCACTGGG - Intronic
1053662396 9:40292819-40292841 GAGGAAAAGCAGATGGCACTGGG + Intronic
1053912850 9:42922984-42923006 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1054374527 9:64439048-64439070 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1054522214 9:66083465-66083487 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1055230824 9:74063128-74063150 AAGGAACAAGAGAAGGAACTAGG - Intergenic
1055698141 9:78910993-78911015 GAGTAATAAAAGATGACACTGGG - Intergenic
1057678245 9:97152979-97153001 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1058328256 9:103725584-103725606 GATAAACATCTGATGGAACTGGG - Intergenic
1060574164 9:124673859-124673881 GAGGAACAAGATTTGGAACTAGG + Intronic
1203526722 Un_GL000213v1:97504-97526 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1203526821 Un_GL000213v1:98145-98167 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1203526940 Un_GL000213v1:98784-98806 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1203527146 Un_GL000213v1:100053-100075 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1203748926 Un_GL000218v1:61304-61326 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1203547370 Un_KI270743v1:138829-138851 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1185722194 X:2391186-2391208 AAGTAAGAACAGATGGCACCAGG - Intronic
1186099931 X:6145164-6145186 GAGTAAGAAGAGATAAAACTGGG - Intronic
1188236577 X:27739124-27739146 GAGTGACAACAAAGGGAAATGGG - Intronic
1189669326 X:43391122-43391144 GAGAAACAAGACAGGGAACTGGG + Intergenic
1191679775 X:63829232-63829254 AAGTAAAAACACATGGAAGTGGG - Intergenic
1191929797 X:66358756-66358778 GAGTAAAAACATGTGGTACTTGG - Intergenic
1195526338 X:105894446-105894468 AAGTCACAAAAGATGGAATTTGG - Intronic
1195558096 X:106250335-106250357 GAGTAACAACAGATGCAAGAAGG - Intergenic
1199376595 X:147118917-147118939 GAATGAGATCAGATGGAACTTGG + Intergenic
1201162284 Y:11176310-11176332 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1201254574 Y:12094157-12094179 GAGTAAGAACACATGGACATAGG + Intergenic