ID: 1150875063

View in Genome Browser
Species Human (GRCh38)
Location 17:68961748-68961770
Sequence GCTACAGGTGAGAAGTGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150875063_1150875066 2 Left 1150875063 17:68961748-68961770 CCTTAGCACTTCTCACCTGTAGC No data
Right 1150875066 17:68961773-68961795 AAGAAATGTATGCTGCACCTGGG No data
1150875063_1150875070 11 Left 1150875063 17:68961748-68961770 CCTTAGCACTTCTCACCTGTAGC No data
Right 1150875070 17:68961782-68961804 ATGCTGCACCTGGGAGGGGTAGG No data
1150875063_1150875072 30 Left 1150875063 17:68961748-68961770 CCTTAGCACTTCTCACCTGTAGC No data
Right 1150875072 17:68961801-68961823 TAGGAGAACTTCTTAGAATTTGG No data
1150875063_1150875068 6 Left 1150875063 17:68961748-68961770 CCTTAGCACTTCTCACCTGTAGC No data
Right 1150875068 17:68961777-68961799 AATGTATGCTGCACCTGGGAGGG No data
1150875063_1150875067 5 Left 1150875063 17:68961748-68961770 CCTTAGCACTTCTCACCTGTAGC No data
Right 1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG No data
1150875063_1150875069 7 Left 1150875063 17:68961748-68961770 CCTTAGCACTTCTCACCTGTAGC No data
Right 1150875069 17:68961778-68961800 ATGTATGCTGCACCTGGGAGGGG No data
1150875063_1150875065 1 Left 1150875063 17:68961748-68961770 CCTTAGCACTTCTCACCTGTAGC No data
Right 1150875065 17:68961772-68961794 AAAGAAATGTATGCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150875063 Original CRISPR GCTACAGGTGAGAAGTGCTA AGG (reversed) Intergenic
No off target data available for this crispr