ID: 1150875064

View in Genome Browser
Species Human (GRCh38)
Location 17:68961763-68961785
Sequence GCATACATTTCTTTTGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150875064_1150875069 -8 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875069 17:68961778-68961800 ATGTATGCTGCACCTGGGAGGGG No data
1150875064_1150875070 -4 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875070 17:68961782-68961804 ATGCTGCACCTGGGAGGGGTAGG No data
1150875064_1150875072 15 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875072 17:68961801-68961823 TAGGAGAACTTCTTAGAATTTGG No data
1150875064_1150875074 19 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875074 17:68961805-68961827 AGAACTTCTTAGAATTTGGTGGG No data
1150875064_1150875067 -10 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG No data
1150875064_1150875068 -9 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875068 17:68961777-68961799 AATGTATGCTGCACCTGGGAGGG No data
1150875064_1150875073 18 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875073 17:68961804-68961826 GAGAACTTCTTAGAATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150875064 Original CRISPR GCATACATTTCTTTTGCTAC AGG (reversed) Intergenic
No off target data available for this crispr