ID: 1150875067

View in Genome Browser
Species Human (GRCh38)
Location 17:68961776-68961798
Sequence AAATGTATGCTGCACCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150875064_1150875067 -10 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG No data
1150875063_1150875067 5 Left 1150875063 17:68961748-68961770 CCTTAGCACTTCTCACCTGTAGC No data
Right 1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150875067 Original CRISPR AAATGTATGCTGCACCTGGG AGG Intergenic
No off target data available for this crispr