ID: 1150875073

View in Genome Browser
Species Human (GRCh38)
Location 17:68961804-68961826
Sequence GAGAACTTCTTAGAATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150875064_1150875073 18 Left 1150875064 17:68961763-68961785 CCTGTAGCAAAAGAAATGTATGC No data
Right 1150875073 17:68961804-68961826 GAGAACTTCTTAGAATTTGGTGG No data
1150875071_1150875073 -9 Left 1150875071 17:68961790-68961812 CCTGGGAGGGGTAGGAGAACTTC No data
Right 1150875073 17:68961804-68961826 GAGAACTTCTTAGAATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150875073 Original CRISPR GAGAACTTCTTAGAATTTGG TGG Intergenic
No off target data available for this crispr