ID: 1150880545

View in Genome Browser
Species Human (GRCh38)
Location 17:69020953-69020975
Sequence TTTATGTTCTTGAAGGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150880545_1150880550 13 Left 1150880545 17:69020953-69020975 CCTCTACCCTTCAAGAACATAAA 0: 1
1: 0
2: 0
3: 26
4: 364
Right 1150880550 17:69020989-69021011 ATATTTTTAAAATATAACCATGG 0: 1
1: 0
2: 10
3: 161
4: 1477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150880545 Original CRISPR TTTATGTTCTTGAAGGGTAG AGG (reversed) Intronic
901935045 1:12620998-12621020 TTTCTGGGCTTGAAGGGAAGAGG + Intergenic
904346177 1:29871468-29871490 TGTTTGTTCTAGATGGGTAGTGG - Intergenic
904464897 1:30701862-30701884 TTGCTGTTCCTGAAGTGTAGGGG + Intergenic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
906245567 1:44271082-44271104 TTTGTGTGCATGAAGGGAAGAGG - Intronic
906369972 1:45245338-45245360 TTGATTTTCTTGAAGAGTACTGG - Intronic
906649164 1:47499234-47499256 TTTATGTTTTTGAGGGGTATTGG + Intergenic
906885730 1:49645742-49645764 TCTATGTTCCTGAGGGGTATTGG - Intronic
907546809 1:55268363-55268385 TTTATATTCATGAAGGATATTGG + Intergenic
907619346 1:55960417-55960439 TTTGTGTTCTTCAAGGGGAATGG + Intergenic
908188083 1:61671795-61671817 TTTATTTTCTTGTAGAGAAGGGG - Intergenic
908222705 1:62024125-62024147 TTTATGTTCATGAGGGATACTGG + Intronic
908460859 1:64347409-64347431 TTAATATTCTTTATGGGTAGTGG + Intergenic
909862604 1:80627899-80627921 TCTATGTTCATGAAGGATATTGG + Intergenic
909970835 1:81986791-81986813 TTTATATTCATCAAGGGTAGTGG - Intronic
910073864 1:83252631-83252653 TCTGTGTTTTTGAAGGGTATTGG + Intergenic
912975457 1:114325368-114325390 TTTATGTTCATGATGGATATTGG - Intergenic
913425478 1:118724148-118724170 TTTATGTTCATTAAGGGTATTGG - Intergenic
915098640 1:153482810-153482832 GTAATGTTCTTGAAGGTGAGTGG + Intergenic
916666002 1:166968124-166968146 TTTGTGCTCCTGAAGGCTAGAGG - Intronic
917693884 1:177498530-177498552 TTTATGTTCATTAAGGTTATTGG - Intergenic
918148118 1:181775641-181775663 TCTATGTTCTTAAATGGTTGAGG + Intronic
919208247 1:194446219-194446241 CTGAGGTTCTTGCAGGGTAGAGG - Intergenic
921007416 1:211108318-211108340 TTTCTGTTTTTGGAGGGTGGGGG - Intronic
921034768 1:211366455-211366477 TGTTAGTTCTTCAAGGGTAGAGG - Intronic
921321627 1:213945851-213945873 TCCAGGTTTTTGAAGGGTAGGGG - Intergenic
921438858 1:215159987-215160009 TTTATGTTTTTGAAGAATGGAGG - Intronic
921610119 1:217202928-217202950 TCTATGTTCATGAGGGATAGAGG + Intergenic
923296417 1:232598952-232598974 TTTTTTTTTTTGAGGGGTAGAGG - Intergenic
923605462 1:235439136-235439158 TTTATGTTCTTGAAATGGAGAGG + Intronic
1062991332 10:1822015-1822037 TTTATGGTCCTGAATGGCAGAGG + Intergenic
1063271892 10:4518588-4518610 TTGATGCTCTTGAAGAGTACTGG + Intergenic
1063854347 10:10230949-10230971 TTTATTATCTTTAAGGGTAAAGG + Intergenic
1064411332 10:15107229-15107251 TTTATTTTCTGGAATGGTTGAGG - Intronic
1064693845 10:17945890-17945912 TTGATGTTCCTCAAGGATAGTGG + Intergenic
1064711214 10:18127850-18127872 TTTAGGTTTTTGAAAGGCAGGGG + Intergenic
1064720956 10:18228018-18228040 TTTACATTCTTTCAGGGTAGGGG + Intronic
1065098971 10:22315324-22315346 TGCAAGTTCTTGAAGGGTGGAGG - Intergenic
1065268851 10:24005923-24005945 TATAAGTTCTTGATGAGTAGAGG - Intronic
1065565509 10:27003789-27003811 TTTATGTTTTTGGAGAGTATAGG - Intronic
1065691599 10:28339631-28339653 TTCATGTGCTTGAAGGGACGTGG + Intergenic
1065815090 10:29475898-29475920 TTTAAGTTCTTAAAAGGTAGGGG + Intronic
1065914428 10:30341414-30341436 TTTATGCTTTTCAAGGGTGGAGG - Intronic
1066692989 10:38050220-38050242 TTTATGTTCATGAAGGACACCGG - Intronic
1066999788 10:42598814-42598836 TTTATGTTCATGAAGGACACTGG + Intronic
1067466728 10:46504745-46504767 TTTTTATTTTTGAAGGTTAGAGG - Intergenic
1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG + Intergenic
1067620460 10:47879860-47879882 TTTTTATTTTTGAAGGTTAGAGG + Intergenic
1068396127 10:56464992-56465014 ATTACGTTTTTGAAGGGTGGAGG - Intergenic
1068540956 10:58294500-58294522 GTTATGTTTTTGAAGGGAAATGG + Intergenic
1070202461 10:74220584-74220606 TTAATGTTCATCAAGGGTATTGG - Intronic
1071317062 10:84412215-84412237 TTTATGTTCATCAAGGATATTGG + Intronic
1071934844 10:90517556-90517578 TTGATGTTCATCAAGGGTATAGG + Intergenic
1072176970 10:92935956-92935978 TTTATGTTATTGTAGATTAGTGG + Intronic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1072504361 10:96049489-96049511 TTTTTTTTTTTGCAGGGTAGGGG + Intronic
1073298613 10:102456805-102456827 TTTATTTTCTTGTTGGGTGGAGG + Intergenic
1075251640 10:120882314-120882336 TCTATGTTCATGAAGGATATTGG + Intronic
1077270211 11:1673906-1673928 TCTATGTTCATGAGGGGTATTGG + Intergenic
1077961850 11:7084056-7084078 TTTATGTTCTTCAAACATAGAGG + Intergenic
1078295131 11:10060595-10060617 TTGATGTTCATCAAGGGTATTGG - Intronic
1078915182 11:15772004-15772026 TTTATGTTCTAAAAGAGGAGTGG + Intergenic
1079255973 11:18830427-18830449 TCTATATTCATGAAGGATAGTGG + Intergenic
1079791364 11:24744139-24744161 TCTATGTTCATGAAGGATATTGG + Intronic
1080509959 11:32959322-32959344 TTTATGTTCTAGAAAAATAGGGG - Intronic
1080552610 11:33386731-33386753 TTCATGTTCATGAGGGGTATTGG + Intergenic
1081116458 11:39207802-39207824 TTGATGTTTTTGAAGAGTAGTGG + Intergenic
1081480358 11:43481323-43481345 TTTATGTTCATGAGGGATATTGG + Intronic
1081565025 11:44254926-44254948 TTTATGTTCAGGAAGGCTACTGG - Intergenic
1082324394 11:51120349-51120371 TCGATGTTCATGAAGGGTATTGG - Intergenic
1084417183 11:69039588-69039610 TTTTTGTTCTTGAAAGATTGGGG + Intergenic
1086040712 11:82474173-82474195 TTTTTGTTTTTGCAGGGGAGGGG + Intergenic
1086067433 11:82761432-82761454 TCTATGTTCCTGAAGGATATTGG - Intergenic
1086611433 11:88760771-88760793 TCAATGTTCATGAAGGGTATTGG - Intronic
1087620095 11:100530837-100530859 TTGATGTTCATCAAGGGTATTGG - Intergenic
1088347841 11:108849147-108849169 ATTTTGTTCTTGGAGGGCAGGGG + Intronic
1088943354 11:114483632-114483654 TTCCTGTTGTTGATGGGTAGGGG + Intergenic
1089049068 11:115530357-115530379 TTGAGGTGCTGGAAGGGTAGTGG + Intergenic
1089109269 11:116042169-116042191 TTTTTTTTCTTGAGGGGCAGGGG + Intergenic
1089481112 11:118805994-118806016 TTTCTCTTCTTGCTGGGTAGAGG - Intergenic
1090119301 11:124008142-124008164 TTTATGAGCATGAAGAGTAGGGG + Intergenic
1090876644 11:130795272-130795294 TTTATATTCTTGAAGTATATTGG - Intergenic
1092772131 12:11906303-11906325 TTTATGTTCTTGAAATCTGGGGG - Intergenic
1093945567 12:25104891-25104913 TTTATGTAAGTGAAGAGTAGAGG + Intronic
1094225909 12:28045854-28045876 TCTATGTTCATCAAGGGTACTGG + Intergenic
1095072181 12:37866794-37866816 TTAATGTTCATCAAGGGTATTGG - Intergenic
1096042790 12:48533423-48533445 TCTATGTTCATGAAGGATAGTGG - Intergenic
1096888296 12:54740410-54740432 TTTATGTTCATCAAGGATATCGG + Intergenic
1097295813 12:57961486-57961508 TCTATGTTCTTCAAGGATATTGG - Intergenic
1098686781 12:73432765-73432787 TTGATGTTCGTCAAGGGTATTGG + Intergenic
1098720732 12:73894240-73894262 TTTGTTTTCCTGAAGAGTAGAGG + Intergenic
1099062148 12:77925068-77925090 TTTACTTTTTTGAAGGGTGGGGG + Intronic
1099209038 12:79762407-79762429 TTTATGTTATTGAGGGATATTGG + Intergenic
1099293431 12:80800818-80800840 TTTATGTTCTTGAGAGATATTGG - Intronic
1099971831 12:89508374-89508396 TTGATGTTCTTGAAGACTATAGG + Intronic
1100577921 12:95909615-95909637 TCTATGTTCATCAAGGATAGTGG - Intronic
1102732357 12:115123459-115123481 TTTATTTTTTTGCAGGGGAGAGG + Intergenic
1104230773 12:126881733-126881755 TTTATGCACTTTAAGGTTAGAGG + Intergenic
1104677579 12:130723972-130723994 TTAATGTTCATCAAGGGTATTGG - Intergenic
1106475265 13:30093023-30093045 TTTATGTGCTTGAAGCTTGGTGG + Intergenic
1107062902 13:36179838-36179860 TTTATGTTCATGAGGGATACTGG + Intronic
1108743075 13:53358968-53358990 TTTAAGTTATAGAAGGGTAAAGG + Intergenic
1108790845 13:53967475-53967497 TCTATGTTCATGAAGGATATTGG + Intergenic
1108828655 13:54449888-54449910 TTTATGTTATTGAAAGGCAATGG - Intergenic
1110775310 13:79402500-79402522 TGGATGTTATTGAAGGATAGTGG - Intronic
1110801810 13:79706691-79706713 TCTATATTCTTGAAGGATATTGG + Intergenic
1111279903 13:86008598-86008620 TTTATGTTCTTGTAGAAGAGTGG + Intergenic
1111526116 13:89473150-89473172 TTTATGTTCATCAAGGATATTGG + Intergenic
1112425535 13:99295718-99295740 TTTATCTTGTTGTAGCGTAGAGG + Exonic
1112790564 13:102997909-102997931 TTGATGTACTTGGAGGGTAAAGG + Intergenic
1113198812 13:107841033-107841055 TATATGCTCTTGAGGGGCAGGGG + Intronic
1114229739 14:20769742-20769764 TTTATGTCCTTGAAGTGGAAAGG - Intronic
1115920962 14:38372873-38372895 CTTATGTTCTCTAAGGGAAGTGG - Intergenic
1117059560 14:51948105-51948127 GAAATGTTCTTGAAGGGAAGAGG - Intronic
1117271658 14:54150276-54150298 TTTATGTTCATAAAGGATATTGG - Intergenic
1118196888 14:63635192-63635214 TTTATGTTCATCAAGGATATTGG - Intronic
1119965094 14:78905985-78906007 TTTATGTTCTATAAGGGGAATGG + Intronic
1123136292 14:106030588-106030610 TTTATATTCTTTAAGAGTTGGGG - Intergenic
1125401425 15:39308405-39308427 TTTATGTTCTTGAAGCATACTGG + Intergenic
1126505815 15:49403206-49403228 TCTATGTTCATCAAGGGTATTGG + Intronic
1127189805 15:56517363-56517385 TTTATGTTCATCAAGGATATTGG - Intergenic
1128803228 15:70510488-70510510 TCTATGTTCTTCAAGGATATTGG - Intergenic
1129560677 15:76563726-76563748 TTGATGTTCTTCAAGGATATTGG - Intronic
1130101353 15:80896629-80896651 TTTATGTTATTGGAGGTTACTGG + Intronic
1130624502 15:85499864-85499886 ATTATGTTCCTTGAGGGTAGGGG + Intronic
1132209986 15:100013811-100013833 TCTATGTTCATGAAGGATATCGG + Intronic
1133678495 16:8098326-8098348 TTTGTTTTGTTGAAGGGTTGGGG + Intergenic
1135855671 16:26007857-26007879 TTTATGTCCTTGGATTGTAGGGG - Intronic
1136633356 16:31502729-31502751 ATAATGTACTTGAAGGGAAGAGG - Intronic
1137823318 16:51466078-51466100 TTTATGTTTTTGTAGAGAAGGGG + Intergenic
1137989379 16:53137787-53137809 TTTATGTTCTTGAAGATAAATGG + Intronic
1138809060 16:60127594-60127616 TTTATGTTCTTTAATCATAGTGG - Intergenic
1139706265 16:68742853-68742875 TTTATGAGTTTGAGGGGTAGGGG - Intronic
1144616928 17:16784893-16784915 TTTATGTGTTTGAAGAGTATGGG + Intronic
1144895763 17:18530781-18530803 TTTATGTGTTTGAAGAGTATGGG - Intergenic
1145136454 17:20413451-20413473 TTTATGTGTTTGAAGAGTATGGG + Intergenic
1145691011 17:26739405-26739427 TCAATGTTCATGAAGGGTATTGG - Intergenic
1146488967 17:33266238-33266260 TTTATGTTCTGGATGGGGGGAGG - Intronic
1146751074 17:35381236-35381258 TCTATGTTCATCAAGGGTATCGG + Intergenic
1146823720 17:36005733-36005755 TTAATGTTCTTTAAGTTTAGAGG + Intergenic
1148274473 17:46291256-46291278 TGTATGTTCTTGAAGGGAGAGGG - Intronic
1149887853 17:60358611-60358633 TTTATATTCTTGAAGCACAGAGG - Intronic
1150408582 17:64923299-64923321 TGTATGTTCTTGAAGGGAGAGGG + Intergenic
1150880545 17:69020953-69020975 TTTATGTTCTTGAAGGGTAGAGG - Intronic
1155456281 18:26018012-26018034 TGTATGTTTATGAAGGGTAAGGG - Exonic
1155935452 18:31748279-31748301 TCTATGTTCATCAAGGATAGTGG + Intergenic
1156084117 18:33378863-33378885 TTTATGTTCATCAAGGATATTGG + Intronic
1156510995 18:37636742-37636764 TTTATGTTCTTAGAGGGCAAGGG - Intergenic
1157058699 18:44260785-44260807 TTTTTATTCTGGAAGGGAAGAGG + Intergenic
1157469954 18:47981589-47981611 TTTATATTCTTGAAGGCAGGGGG + Intergenic
1157553241 18:48595597-48595619 TTTATTTTTTTGTAGGGTTGGGG + Intronic
1158501606 18:58007395-58007417 TGTAAGTTCTTTAAGGGAAGAGG + Intergenic
1159307401 18:66662093-66662115 TTTATGTTCCTGAAGAATTGAGG + Intergenic
1160139304 18:76306731-76306753 TTTATATTCATGAAGGATATTGG + Intergenic
1162656311 19:12133448-12133470 TTCATGTACTGGAAGGGTAGTGG + Exonic
1163853354 19:19679954-19679976 TTCATGTGCTTGAAGGGACGTGG - Exonic
1163971922 19:20806658-20806680 TTTATGTTTAGTAAGGGTAGAGG - Exonic
1164215804 19:23146015-23146037 TTTATGTTTTGTAAGGGTTGAGG - Exonic
1165964488 19:39564038-39564060 TTTATGTCCTTGAGGCGTGGGGG + Intergenic
1166533667 19:43557891-43557913 TTGATGTTTTTGAAGAGTAGAGG + Intronic
926915694 2:17889852-17889874 TCTATGTTCTTCAAGGATATCGG + Intronic
927100452 2:19783876-19783898 TGTGTGTGTTTGAAGGGTAGTGG - Intergenic
927127806 2:20028854-20028876 TTTATGTTCTTCAGGGATATTGG - Intergenic
927262571 2:21107490-21107512 TTCATGTTTGTGAAGGGTACTGG + Intergenic
927350331 2:22105022-22105044 TTTATGTTCATGAGGAGTATTGG - Intergenic
928464412 2:31508774-31508796 TTTATGTTCATGAGGGATATTGG - Intergenic
928877566 2:36058065-36058087 TTTTTGTTCTTTATGGGCAGAGG + Intergenic
931653530 2:64489647-64489669 TTGATTTTCTAGAAGGGAAGGGG + Intergenic
932282365 2:70504834-70504856 TGTATGTTTTTGAAGCATAGTGG + Intronic
932856491 2:75240211-75240233 ATTATATTCTTGAAGGGAGGAGG - Intergenic
934621936 2:95816189-95816211 TTGATGTTCATCAAGGGTATTGG + Intergenic
935381701 2:102458243-102458265 TTTATGTTATTCAATGGCAGTGG - Intergenic
935834984 2:107040734-107040756 TTGATGTTCTTCAAGGATATTGG - Intergenic
937680562 2:124640188-124640210 TTTATGGTCTTAGGGGGTAGTGG - Intronic
938637382 2:133243528-133243550 TTTATGTAGTTGCAGGGAAGAGG - Intronic
938886301 2:135652577-135652599 TCTATGTTCATGAAGGATATTGG + Intronic
939407432 2:141776492-141776514 TCTATGTTCCTGAACAGTAGAGG + Intronic
940469325 2:154074651-154074673 TTTATGTTCATCAAGGATATTGG - Intronic
941223765 2:162819023-162819045 TTGATATTCTTTAAGGGTACAGG - Intronic
941506549 2:166353180-166353202 TTTGTATTTTTGAAGGGAAGGGG - Intronic
941627743 2:167848306-167848328 TCTATGTTCATGAAGGATATAGG - Intergenic
941780753 2:169441917-169441939 TTTATGTTCTCAAAGGTTATGGG + Intergenic
941889738 2:170567389-170567411 TTGATGCTAGTGAAGGGTAGGGG + Intronic
941932674 2:170957831-170957853 TTTATGTTTTTGTAGGGCTGGGG + Intronic
942714900 2:178881104-178881126 TTTTTGTTCTTAAAGCGTGGTGG - Intronic
943000672 2:182324624-182324646 TTTATTTTCTTGTAGGTTTGGGG - Intronic
944109517 2:196117209-196117231 GTAATGTTCTTTAAGGGTACTGG + Intergenic
944141663 2:196463394-196463416 TTTTTTTTTTTGCAGGGTAGAGG - Intronic
944262782 2:197695258-197695280 TCTATGTTCTTCAAGGATATTGG + Intronic
944338308 2:198564706-198564728 TCTATGTTCATGAAGGATATTGG + Intronic
945133688 2:206602480-206602502 TTTCTTGTCTTGAATGGTAGTGG + Intronic
946518292 2:220437393-220437415 TTTATGTACTTGAAGGAAAGAGG + Intergenic
946968289 2:225063867-225063889 TTTATATTCTACAAAGGTAGTGG - Intergenic
1168791046 20:576045-576067 TTTAAGTCCTGGAAGGGTAGAGG + Intergenic
1168902130 20:1373927-1373949 TTTCTGTTCCTGCAGGGCAGAGG - Intronic
1173412943 20:42830160-42830182 TTAATGTTCTTCAAGGATATTGG - Intronic
1174982331 20:55410222-55410244 TTTATATTAATGAAGGGTATGGG - Intergenic
1175353147 20:58340643-58340665 TTTAAGTTCTTTGAGTGTAGGGG - Intronic
1176175438 20:63720990-63721012 TTTCTGTTCTTTTAGGTTAGTGG + Intronic
1176971968 21:15276748-15276770 TTTATGTTCATGAATTGTAAAGG + Intergenic
1177174142 21:17685983-17686005 TCTATGTTCTTCAAGGATATTGG + Intergenic
1177480466 21:21680212-21680234 TCTATGTTCTTCAAGGATATTGG + Intergenic
1177592089 21:23184477-23184499 TTAGTGTTCCTGAAGAGTAGGGG - Intergenic
1178381310 21:32111832-32111854 TTTATGTTCATGAAAGATACTGG + Intergenic
1178427771 21:32492476-32492498 TTTTTGTTGTTAGAGGGTAGAGG + Intronic
1178670550 21:34587499-34587521 TTTATGTTCATGAAAGATATAGG - Intronic
1180259120 21:46655269-46655291 TTTATGTTCATGAGGGTTATTGG - Intronic
1183118348 22:35709942-35709964 TTTATGCTCTTGCATTGTAGGGG + Intergenic
1184951281 22:47844151-47844173 TTTATGAACTTGAAAGGTAAAGG - Intergenic
949601512 3:5603646-5603668 TCTATGTTCATTAAGGGTACTGG - Intergenic
950843589 3:15992081-15992103 TCTATGTTCATGAAGGATATTGG + Intergenic
952079792 3:29744193-29744215 TTCCTGTTCCTCAAGGGTAGAGG + Intronic
952610875 3:35207169-35207191 TTTATGTTCATGAAAGATACTGG + Intergenic
952876181 3:37946421-37946443 TTTATGTTTTTTAAGTGTAAAGG + Intronic
954574642 3:51669176-51669198 TTTAATTTCTTCAAGGGGAGGGG + Intronic
954843007 3:53529430-53529452 TGTATGTTCTTGAGGGATATTGG + Intronic
955900702 3:63750932-63750954 TGTATGCTTTTGAAGGGCAGAGG - Intergenic
959079081 3:101780668-101780690 TTAATGTTCATGCAGGGTTGAGG + Intronic
959858936 3:111194720-111194742 TTTGTATTCTGGAAGGTTAGAGG + Intronic
960012919 3:112852907-112852929 TTTATGTTCATCAAGGATATTGG - Intergenic
960015349 3:112881665-112881687 TTTATGTTCATCAAGGATACTGG + Intergenic
960462044 3:117947856-117947878 TCTATGTTCATGAAGGATATTGG + Intergenic
960521998 3:118665650-118665672 TTTATCTGCTTGCTGGGTAGGGG + Intergenic
960643132 3:119847807-119847829 TTTATGTTTTTAAAAGGTGGTGG + Intronic
960833301 3:121875172-121875194 TGCATGTTGTTGAGGGGTAGTGG + Intronic
961161208 3:124727921-124727943 TATATTTTTTTGAAGGGGAGTGG + Intergenic
962138477 3:132763069-132763091 TCAATGTTCATGAAGGATAGTGG + Intergenic
962734344 3:138311456-138311478 TCTATGTTCTTCAAGGATATTGG - Intronic
963703574 3:148657360-148657382 TTCATTTTCTTGAAGGGCAAAGG + Intergenic
964569962 3:158099696-158099718 TATAGGTTTTTAAAGGGTAGTGG + Intronic
964611142 3:158616717-158616739 TCTATGTTCATGAAGGATATTGG + Intergenic
965492854 3:169361172-169361194 TTTATGTTCTTGTAGTGCGGTGG - Intronic
965824138 3:172713810-172713832 TTTATATGCTTGGAGGGTGGTGG + Intergenic
966888698 3:184390752-184390774 TTTATGATCTGGTAGGGCAGGGG + Intronic
968197357 3:196718645-196718667 TGTATGTTCATGAAGGCTACTGG + Intronic
968436847 4:596719-596741 TTGATTTTCTTGAAGGGTTTTGG + Intergenic
970113491 4:12664974-12664996 TTTGTGTTTTTGAAGAGAAGGGG + Intergenic
970753593 4:19396628-19396650 TCAATGTTCTTCAAGGGTATTGG - Intergenic
971621534 4:28860167-28860189 GTTATGTTTTTGAAGGGTCAGGG - Intergenic
971902107 4:32673669-32673691 TTTATCTTCATGAAGAGTAGTGG - Intergenic
972010510 4:34174630-34174652 TTTATGTTCATCAAGGATAATGG - Intergenic
972136022 4:35895240-35895262 TTGATGTTCATCAAGGGTATTGG - Intergenic
973880575 4:55267736-55267758 TTTCCTTACTTGAAGGGTAGAGG - Intergenic
974664135 4:64936218-64936240 AGTATGTTATTGAATGGTAGAGG - Intergenic
975097302 4:70471964-70471986 CTTATGTGCTTGATGAGTAGTGG - Intronic
975155281 4:71065295-71065317 GTTAAGTTAATGAAGGGTAGGGG + Intergenic
975366806 4:73539180-73539202 TTTATTTTCTTGAATGGAGGTGG - Intergenic
976120284 4:81773193-81773215 TTTATTCTCTTTAAGGATAGAGG + Intronic
977831566 4:101600145-101600167 TTTATTTTTTTGAAGGAAAGTGG + Intronic
978771492 4:112461091-112461113 TGTATGTTCATCAAGGGTATTGG - Intergenic
978825973 4:113023940-113023962 ATTATCTTCTTGTAGTGTAGAGG - Intronic
978959250 4:114655927-114655949 TTGATGTTGTTGAAGGATATCGG + Intronic
979418727 4:120477054-120477076 TGTATGTTCATGAGGGATAGTGG - Intergenic
979823625 4:125205265-125205287 TTTTTGTTTTTGCAGAGTAGGGG - Intergenic
980019887 4:127696116-127696138 TGTATGTTCTTGAAAGATACTGG + Intronic
980915305 4:139027878-139027900 TTTATATTTTTAAATGGTAGGGG - Intronic
981460185 4:145004772-145004794 TCTATGTTCATGAAGGATATTGG + Intronic
981627322 4:146773664-146773686 TTTATGTTCTTCAAGGATATTGG + Intronic
982591173 4:157313536-157313558 TTTAAGGTCTTTCAGGGTAGGGG + Intronic
982635112 4:157886188-157886210 TTTATATTCTTGCAAGGTAGTGG + Intergenic
982896455 4:160933910-160933932 CTAATGTTCCTGAAGGGTCGAGG + Intergenic
984137437 4:175958449-175958471 TTTATGGTTCTCAAGGGTAGTGG - Intronic
984168930 4:176338049-176338071 TTAATGATCTTGAAGCGTATAGG + Intergenic
984498416 4:180528603-180528625 TATATGTTCATGAAGAGTAGAGG - Intergenic
985188852 4:187349355-187349377 TTTATGATTTTGCAGTGTAGAGG - Intergenic
985367779 4:189251104-189251126 TTAATGTTCGTGAAGGATATTGG - Intergenic
985368435 4:189259667-189259689 TTTATGTTCATGAAAGATAGTGG + Intergenic
986234975 5:5900756-5900778 TTTATAATCATGAAGGGTTGAGG + Intergenic
986513706 5:8538302-8538324 TTTATGTTCTTGAGGAATATTGG - Intergenic
987548300 5:19342829-19342851 TTTAAGATCTTTAATGGTAGTGG + Intergenic
987572236 5:19679012-19679034 TTTATGTTCATCAAGGATATTGG - Intronic
988325822 5:29766131-29766153 TTTATGTTCTTCAGGGATATTGG + Intergenic
988357130 5:30192509-30192531 TTAATGGTTTTGAAGAGTAGTGG + Intergenic
988783013 5:34540742-34540764 TTTCTGTTCTTGCAACGTAGGGG - Intergenic
988882508 5:35518536-35518558 TTAAAGTTCTTGAAAGTTAGTGG - Intergenic
989128807 5:38083599-38083621 TTTATCTTCTTGCAGGGCAAAGG + Intergenic
989554862 5:42782040-42782062 CTTAGGTTGTTGAAGGATAGGGG - Intronic
990390635 5:55316347-55316369 TTGATGTTCATCAAGGATAGTGG - Intronic
990922920 5:60987497-60987519 TTTATGTTCATGAAAGATATTGG - Intronic
991027696 5:62048460-62048482 TTTATGTTCATCAAGGATACCGG + Intergenic
991252436 5:64578541-64578563 TTTTTGGTCTCAAAGGGTAGAGG - Intronic
992310549 5:75494494-75494516 TGTCTGGTCTTGGAGGGTAGAGG - Intronic
992533630 5:77675727-77675749 TTTGTGATGTTGAAGAGTAGTGG - Intergenic
994097767 5:95862563-95862585 TAGATGTTCTTCCAGGGTAGAGG + Intergenic
994468915 5:100177220-100177242 TCTATGTTCATGAAGGATATTGG - Intergenic
995520703 5:113002048-113002070 TTTGTTTTCTTGTAGGGGAGAGG + Intronic
995818130 5:116194879-116194901 TCTATGTTCATCAAGGGTATTGG - Intronic
995842885 5:116461158-116461180 TTTCTGATTTTGAAGGTTAGAGG - Intronic
996053486 5:118958663-118958685 TTTATGTTCATCAAGGATATTGG - Intronic
996627794 5:125590301-125590323 TTTGTTTGCTTGAAAGGTAGGGG + Intergenic
996806495 5:127461307-127461329 TTCTTGTTCTTGAAGGACAGAGG + Intronic
997393615 5:133538233-133538255 TTAATATTTTTGAAGGGTACAGG + Intronic
998264395 5:140656902-140656924 TGTATATTTTAGAAGGGTAGGGG - Intronic
999109160 5:149102387-149102409 TCTATGTTCCTCAAGGGTATTGG - Intergenic
999971315 5:156866706-156866728 TTTAAGTTCTTGAAGGGAAAAGG + Intergenic
1001215904 5:169855508-169855530 TTTATGCTCTAGGATGGTAGTGG + Intronic
1001764614 5:174235579-174235601 TTTAAGTTCTTGAAGTGATGGGG - Intronic
1002953580 6:1840310-1840332 TGTATGTTCTGGAAGGGGTGAGG - Intronic
1003438102 6:6112441-6112463 TTGATGTCCTTGCAGGGTGGGGG + Intergenic
1003705118 6:8518944-8518966 TCTATGTTCGTGAAGGTTATTGG - Intergenic
1003865109 6:10355811-10355833 TCTAAGTTCTTGGAGGGCAGGGG - Intergenic
1004766215 6:18730268-18730290 TCTATGTTCTTTAAGGATATTGG - Intergenic
1005342085 6:24852523-24852545 ATTATGGACCTGAAGGGTAGGGG - Intronic
1005486214 6:26302625-26302647 TTTATGTTTTTGAACTGTAGTGG - Intergenic
1007826372 6:44603883-44603905 TTGATGTTCTTCAAGGGAAGTGG + Intergenic
1009265776 6:61552925-61552947 TCTATGTTCATCAAGGGTACTGG + Intergenic
1009497566 6:64370448-64370470 TCTATGTTCTTCAAGGATATTGG + Intronic
1010751912 6:79625494-79625516 TTGATGTTATTGAAGTTTAGAGG - Intergenic
1011921341 6:92580908-92580930 TTTATATTCATGAAGGATATTGG - Intergenic
1012250975 6:96980588-96980610 TTTATGTTCATCAAGGATACTGG + Intronic
1013885087 6:114954135-114954157 TTTATGTTCTTCAGGGATATTGG + Intergenic
1014604204 6:123451811-123451833 TTTATGTTCATCAAGGATATTGG - Intronic
1014812664 6:125903991-125904013 CATATGTACTTAAAGGGTAGTGG - Intronic
1014882542 6:126741562-126741584 TTTTTGTTTTTAAAGGGCAGGGG - Intergenic
1015030172 6:128585735-128585757 TTGGTGTCCTTGCAGGGTAGTGG - Intergenic
1016333410 6:142977981-142978003 TTTATGTTCTTCAGGGATATTGG - Intergenic
1016423395 6:143909195-143909217 TTGATGTTCATCAAGGGTATTGG + Intronic
1016887030 6:148968116-148968138 CTTATGTTCCTGAAGGGTAAAGG + Intronic
1017541834 6:155411081-155411103 TTTATGTTCTTAAAAGGGAAAGG - Intronic
1021513914 7:21461966-21461988 TGTATATTTTTGAGGGGTAGGGG + Intronic
1021793777 7:24232637-24232659 TCTATGTTCATGAAGGATACTGG - Intergenic
1022428139 7:30286737-30286759 TTTATTTTCATAAAGGGGAGAGG - Intronic
1024708034 7:51982739-51982761 TTTATGCTCTTGAAGTCTAGAGG - Intergenic
1027333891 7:77127527-77127549 TTTATTTTCATGAAGGATATTGG + Intronic
1027887964 7:83933705-83933727 TTTATTTTCTTGTAGTGGAGAGG + Intergenic
1027917067 7:84338681-84338703 TTTGTGTTCTTGTATGGTTGCGG - Intronic
1028535433 7:91886443-91886465 TTTATGAACTTGAAGTGTAAAGG - Intergenic
1029781899 7:102743787-102743809 TTTATTTTCATGAAGGATATTGG - Intergenic
1031252220 7:119399660-119399682 TTCATTTTTTTGAAGGGAAGAGG + Intergenic
1031360087 7:120838905-120838927 TTTTTCTTCTTTCAGGGTAGAGG - Exonic
1031608924 7:123801948-123801970 TTTTTGTTCCTAGAGGGTAGAGG + Intergenic
1032719743 7:134540911-134540933 CTTATGTTCTTGCAGGGAGGAGG + Intronic
1032774840 7:135101561-135101583 TTTATTTTCTTGGCGGGTGGTGG - Intronic
1032830313 7:135618208-135618230 TGTATGTGCATGAAAGGTAGGGG - Intronic
1032849870 7:135784882-135784904 TGTAAGCTCTTGAAGGCTAGGGG - Intergenic
1035909426 8:3549225-3549247 TCTATGTTCTGAAAGGGTTGTGG + Intronic
1037797898 8:22011454-22011476 TCTATGTTCATGAAGGATAGTGG - Intergenic
1038272305 8:26085191-26085213 TTGATGTTCTTGAGGACTAGTGG - Intergenic
1039593977 8:38774670-38774692 TTTTTGTTTTTGAAGGGATGGGG + Intronic
1039663398 8:39492635-39492657 TTTATGATTTTGAAGGGTCTAGG - Intergenic
1040608225 8:48956328-48956350 TTGATGTTCTTCAGGGATAGTGG + Intergenic
1041013150 8:53563845-53563867 TTTATGTTCATCAAGGATATTGG - Intergenic
1042041244 8:64592488-64592510 AGTATGTTCTTGAAGGGGAAGGG + Intronic
1042429300 8:68686346-68686368 TCTATGTTCATCAAGGGTATTGG - Intronic
1044200646 8:89431646-89431668 TTTATGTGTTTGAAGGGAAAAGG + Intergenic
1044893666 8:96864483-96864505 TCTGTGTTCTTAAAGGGTACGGG + Intronic
1045089810 8:98730244-98730266 TATATTTTCTTGAAGGCTGGTGG - Intronic
1046448918 8:114361759-114361781 TTGATGTTCTTCAAGGATATTGG - Intergenic
1046617295 8:116491252-116491274 TTGATGTTTATGAAGGGTTGGGG - Intergenic
1047530813 8:125673281-125673303 TTTATGTTCATCAAGGATATTGG + Intergenic
1047638098 8:126788533-126788555 ATTATGTTCTTGAAGAATATCGG + Intergenic
1048148103 8:131865236-131865258 TTTATGTTCTTACAGGTTTGAGG - Intergenic
1048754247 8:137718276-137718298 TTAATGTTCTTTATGGGTTGTGG - Intergenic
1051997921 9:23241453-23241475 TTTATGTTCATCAAGGATATTGG - Intergenic
1052003817 9:23322113-23322135 TTTATGAGCCTGAAGTGTAGAGG - Intergenic
1055165809 9:73191583-73191605 TTTATGATTTTGAAGGGTCTAGG + Intergenic
1056287360 9:85103921-85103943 TCTATGTTCATGAAGGATACTGG + Intergenic
1058101562 9:100923043-100923065 TTGATGTTCATGAAGGATATTGG - Intergenic
1059086852 9:111312483-111312505 TTTATGTTCTTGAATAAAAGTGG + Intergenic
1059108004 9:111528102-111528124 CTTGTGTTCTTGAAGGGGATGGG - Intronic
1059463956 9:114453878-114453900 TTTGTGTTCATGAAGGATAGTGG - Intronic
1061575946 9:131506243-131506265 TTTGAGGTCCTGAAGGGTAGGGG - Intronic
1061646510 9:132006902-132006924 TTTCTGTTCTTGAAAGTCAGAGG - Intronic
1188045578 X:25422780-25422802 TCTATGTTCATGAAGGATATTGG + Intergenic
1188529324 X:31121721-31121743 TATATTTTTGTGAAGGGTAGTGG - Exonic
1188775502 X:34213503-34213525 TCTATGTTCATGAAGGATATTGG - Intergenic
1190885249 X:54525969-54525991 TTTATGTTTTTGAAGAGTCCAGG - Intergenic
1191150655 X:57218626-57218648 TCTATGTTCATCAAGGATAGTGG + Intergenic
1191815980 X:65245404-65245426 TTTATGTTCATCAAGGATATTGG - Intergenic
1192188173 X:68970754-68970776 TTTATGTTCTTCAGGGATATTGG - Intergenic
1192863597 X:75106842-75106864 TTGGTGTCCTTGAAGGGAAGGGG - Intronic
1193029863 X:76885901-76885923 TTAATGTTCATCAAGGATAGTGG - Intergenic
1193233341 X:79075278-79075300 TTGATGTTCTTGAGGGATATTGG - Intergenic
1193638986 X:83988335-83988357 TTTATTTTCATGAAGGATATTGG - Intergenic
1193646254 X:84072131-84072153 TCTATGTTCTTTAAGGCTATTGG - Intronic
1193943551 X:87705816-87705838 TTTATGTGTGTGAAAGGTAGAGG - Intergenic
1194182242 X:90726650-90726672 TTTATGTTCTTCAGGGATATTGG - Intergenic
1194206014 X:91012315-91012337 TCTATGTTCATCAAGGGTATTGG + Intergenic
1195642183 X:107188171-107188193 TTTATGTTCATGAAGGATATTGG - Intronic
1195838578 X:109147330-109147352 TCTATGTTCATCAAGGGTATTGG - Intergenic
1195965127 X:110423011-110423033 TTTATGAGCGTGAAGGGTACAGG - Intronic
1196551073 X:117025926-117025948 TTTATGTTCATCAAGGCTATTGG + Intergenic
1197292455 X:124675650-124675672 TGTAAGTTCTGGGAGGGTAGAGG - Intronic
1197406637 X:126061507-126061529 TTGATGTTCTTCAAGGATATTGG - Intergenic
1197471916 X:126874115-126874137 TTTATGTTCATTAGGGGTATTGG + Intergenic
1197573706 X:128181393-128181415 TTAATGTTCATCAAGGGTATTGG - Intergenic
1197600924 X:128528705-128528727 TCTATGTTCTTCAAGGATATTGG - Intergenic
1199786263 X:151108360-151108382 TCTATGTTCATCAAGGGTAATGG + Intergenic
1200336597 X:155357421-155357443 TTGATGTTCATGAAGGATACTGG - Intergenic
1200349873 X:155483806-155483828 TTGATGTTCATGAAGGATACTGG + Intergenic
1201908722 Y:19111345-19111367 TCAATGTTCATGAAGGGTATTGG + Intergenic