ID: 1150883335

View in Genome Browser
Species Human (GRCh38)
Location 17:69056960-69056982
Sequence TGGTGTGAAAATGCATTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150883330_1150883335 25 Left 1150883330 17:69056912-69056934 CCCAAGAGGTAGGAAGACTTGGA 0: 1
1: 0
2: 0
3: 20
4: 256
Right 1150883335 17:69056960-69056982 TGGTGTGAAAATGCATTTTGGGG 0: 1
1: 0
2: 5
3: 30
4: 314
1150883331_1150883335 24 Left 1150883331 17:69056913-69056935 CCAAGAGGTAGGAAGACTTGGAA 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1150883335 17:69056960-69056982 TGGTGTGAAAATGCATTTTGGGG 0: 1
1: 0
2: 5
3: 30
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150883335 Original CRISPR TGGTGTGAAAATGCATTTTG GGG Intronic
900077508 1:829472-829494 TGCTGTGAAAGTGTATTGTGGGG + Intergenic
903686681 1:25136889-25136911 TTTTGTGAAGATCCATTTTGGGG - Intergenic
904222265 1:28981739-28981761 TGTTGTGAAAATGGACCTTGTGG - Intronic
905370324 1:37479541-37479563 TGGGGTGAAGAGGCATTTGGGGG + Intronic
905841928 1:41188121-41188143 GGCTCTGAACATGCATTTTGAGG - Intronic
908251086 1:62266448-62266470 TGGTGTGAGCATGCAGTGTGAGG - Intronic
909502527 1:76351905-76351927 GGATGTGAAAATTCATGTTGAGG + Intronic
910143160 1:84049484-84049506 TGCTGTGAATATTGATTTTGGGG - Intergenic
910420451 1:87055825-87055847 TTATGTGAAAATGGCTTTTGAGG - Intronic
911168951 1:94750959-94750981 TGTTGTGATAATGCACTTTTGGG + Intergenic
911518858 1:98904371-98904393 TAATTTGAAAATGCTTTTTGAGG - Intronic
917475993 1:175369563-175369585 TGGGGTGGACATGCATTTTGAGG + Intronic
917680436 1:177360721-177360743 TTGGGTGAACATGCATTTTAAGG + Intergenic
918757913 1:188360198-188360220 TTGTTTAAAAATGTATTTTGTGG + Intergenic
919530913 1:198719108-198719130 TTGGGTCAAAATGTATTTTGAGG + Intronic
919568488 1:199218669-199218691 TGGTGGGAAACTGCAGTGTGGGG + Intergenic
921214294 1:212924101-212924123 TGTTCAGAAAATGCATTTTAGGG + Intergenic
922504496 1:226118710-226118732 TGGTGTGAATGGGCATTTTCTGG + Intergenic
924574132 1:245263778-245263800 TCTTGTCAAAATGCATTTTTTGG - Intronic
924749608 1:246873758-246873780 TGGGGTGAAAGTGAAGTTTGGGG - Intronic
1065669645 10:28102456-28102478 TGGTGTGAAAGTACACTATGTGG - Intronic
1066472414 10:35711989-35712011 TGGTGTGTGAATTCTTTTTGTGG + Intergenic
1066507727 10:36062899-36062921 TGGGGTGATCATGCTTTTTGAGG - Intergenic
1066512309 10:36115032-36115054 TTGTGTCAAAATGCACTGTGGGG + Intergenic
1067723579 10:48749410-48749432 TGGTGTGTAAGTGCAGTGTGTGG - Intronic
1070311904 10:75279983-75280005 GGGGGTTAAAATGAATTTTGTGG + Intergenic
1070335704 10:75453673-75453695 ATGTATTAAAATGCATTTTGGGG + Intronic
1073058805 10:100720324-100720346 AGGTGTGACAGGGCATTTTGGGG + Intergenic
1074238212 10:111607716-111607738 CATTGAGAAAATGCATTTTGGGG + Intergenic
1074304283 10:112262427-112262449 TGATGTCAACAGGCATTTTGTGG + Intergenic
1074500973 10:114024609-114024631 TCGTGTGAATATGCATGTTGTGG - Intergenic
1074934671 10:118166165-118166187 TGGGATAAAAATGCATGTTGGGG - Intergenic
1075361978 10:121846579-121846601 TGGTGTTAAAATGCTGTTTGGGG + Intronic
1075424248 10:122329137-122329159 AAGTGAGAAAATGCATATTGAGG + Intronic
1077956571 11:7027014-7027036 AGGTGTGTGAATGCATTGTGTGG - Intronic
1078969831 11:16395480-16395502 TGGTGTAAAAAAGAATTTAGAGG + Intronic
1079336211 11:19572983-19573005 TTGTGTAAAAATGCAATTTGTGG - Intronic
1079602240 11:22323927-22323949 TTGGGTGAACATGAATTTTGGGG - Intergenic
1080832430 11:35908129-35908151 TGGCTTGCATATGCATTTTGAGG - Intergenic
1081656332 11:44859906-44859928 TCGTGTGAAAATGCATTCCTGGG - Intronic
1082990557 11:59204350-59204372 TGGTGTGAAAATACTTTTCATGG + Intronic
1083133019 11:60644479-60644501 TGGTGTGTATATACATATTGTGG + Intergenic
1083204976 11:61143250-61143272 TGGAATGAAAATGCCTTTTCAGG + Intronic
1085021953 11:73215622-73215644 TGCTCTGAAAATGCATGCTGGGG - Intergenic
1085468530 11:76740698-76740720 TGTAGTGAACATGTATTTTGTGG - Intergenic
1089671726 11:120061754-120061776 TGTGGTGAAACTGCATTTTCTGG + Intergenic
1090525455 11:127529635-127529657 TGGTGTAAAATTGTATATTGTGG - Intergenic
1090828501 11:130404698-130404720 GGCTGTGAAAATGGATTGTGAGG - Intergenic
1091036500 11:132238445-132238467 TGGTCAGAAAATGGATTCTGTGG - Intronic
1092300523 12:7244571-7244593 TGGTGTTAATACTCATTTTGTGG - Intergenic
1092649303 12:10615493-10615515 TGGTGTGAAAATTCATGTTTGGG + Intergenic
1093870151 12:24281368-24281390 TGCTGGGAAAATGCAGATTGGGG - Intergenic
1093885920 12:24460619-24460641 TGATGTGAAAATGCTTTTACAGG - Intergenic
1093917240 12:24818438-24818460 TGGTCTGAGAATACACTTTGAGG - Intronic
1094303452 12:28991973-28991995 TGGTGTAAAAATCAATTCTGAGG - Intergenic
1094437851 12:30441208-30441230 AAGTTTTAAAATGCATTTTGAGG - Intergenic
1094651236 12:32377798-32377820 TGATGTGATAAAACATTTTGTGG + Exonic
1096279083 12:50236233-50236255 TTGTTTGAATTTGCATTTTGAGG - Intronic
1096675809 12:53225155-53225177 TGGGGTGAAAATGAAGTCTGGGG + Intronic
1098779580 12:74669737-74669759 AGGCGTGAAAATCCATTTTGAGG + Intergenic
1098881905 12:75925906-75925928 TAGTTTGAAAATGCATGTTTTGG - Intergenic
1099654897 12:85477994-85478016 TGGACTGAAATTGCACTTTGTGG + Intergenic
1101353107 12:103951067-103951089 AGCTTTGATAATGCATTTTGTGG - Exonic
1101764624 12:107686280-107686302 TGTTGTCAAAAAGCCTTTTGGGG - Intronic
1102427759 12:112857755-112857777 TGGCGTGCAATGGCATTTTGTGG + Intronic
1102623788 12:114218256-114218278 TGGTGTCAGACTGCATTCTGGGG + Intergenic
1106209171 13:27625041-27625063 AGGAGAGAAAATGCATTCTGGGG + Intronic
1106303680 13:28492548-28492570 TGGTGTGCACATGCATTGAGAGG - Intronic
1106616224 13:31331060-31331082 TTTTGTGAAAATGGATTCTGTGG + Exonic
1107385772 13:39907319-39907341 TGGAGTTAGAATGGATTTTGAGG - Intergenic
1107780341 13:43894773-43894795 TGTTGAGAAAATGCATCTTTTGG + Intergenic
1108427652 13:50320057-50320079 TTGTGAGAAAATACATTTTGTGG - Intronic
1108795661 13:54026918-54026940 TGGTGTGAGATGGCATATTGTGG - Intergenic
1109043576 13:57376686-57376708 TGGGGTTATAATGCATATTGTGG - Intergenic
1109482853 13:62979082-62979104 TTATGTGAATATGCATTTTGTGG + Intergenic
1109582050 13:64353111-64353133 TGTTGTTAAAATGCAATTTCTGG + Intergenic
1109862291 13:68216043-68216065 TAGTGTCAAAATGATTTTTGTGG - Intergenic
1111087080 13:83390076-83390098 TGGTATGAAAATAGATTATGAGG - Intergenic
1112206709 13:97331056-97331078 TGGTGTGAAAGTTTATTCTGTGG + Intronic
1112408150 13:99138955-99138977 TTGTGTCACAATGCTTTTTGGGG + Intergenic
1114150440 14:20032307-20032329 AAGTTTGAAAATGCATTTTGAGG + Intergenic
1114983994 14:28203185-28203207 TGGTTTCAAAATTCATTTTTAGG - Intergenic
1116006893 14:39302759-39302781 TGGTGTGAGAATACATTAAGGGG - Intronic
1117799386 14:59427696-59427718 TGGTGTTAAAGCGCATTTAGTGG + Intergenic
1118875092 14:69777611-69777633 TGGTGTTAAAGTGCACTTTGAGG + Intronic
1118927356 14:70204949-70204971 TGGTGCCAAAATGCATTTGGTGG + Intergenic
1120360655 14:83497608-83497630 TGGTGTGTACTGGCATTTTGTGG - Intergenic
1122763931 14:104051652-104051674 TGGTGTGAGATGGTATTTTGTGG + Intronic
1122897954 14:104769680-104769702 TGTTGTTCAAATGCATTTTGGGG - Exonic
1123798080 15:23793869-23793891 TGCTGTGCATATGCTTTTTGAGG + Intergenic
1123890310 15:24771891-24771913 TTGTATGCACATGCATTTTGTGG - Intergenic
1125784965 15:42308281-42308303 TGGTGTGATTCTGCATGTTGTGG - Exonic
1125975006 15:43943485-43943507 CTGTGTGAACATGAATTTTGGGG - Intronic
1126087932 15:45026365-45026387 TTGTCAGCAAATGCATTTTGGGG + Intronic
1126645085 15:50867773-50867795 TGGCCTGCATATGCATTTTGTGG - Intergenic
1126692798 15:51300882-51300904 TGGTGTCCAAATTCAGTTTGGGG - Intronic
1127442991 15:59029670-59029692 TGGTTTCAAAATGTATTTTATGG + Intronic
1128434693 15:67635147-67635169 AGTAGTGACAATGCATTTTGGGG - Intronic
1128986480 15:72225480-72225502 GGGTGTCAAAATGCATGATGTGG - Intronic
1129057456 15:72831135-72831157 TGGGGTTGACATGCATTTTGGGG + Intergenic
1129126558 15:73446885-73446907 TGGTGTGAAGATGGAATTGGAGG + Intronic
1130030784 15:80311508-80311530 AAGTTTTAAAATGCATTTTGAGG + Intergenic
1131868650 15:96738714-96738736 TGGTGTGAATATGTTTTATGGGG - Intergenic
1133923668 16:10177658-10177680 TGGGATGAAACTGCGTTTTGGGG - Intronic
1135060497 16:19267385-19267407 AGGGTTGAAAGTGCATTTTGGGG - Exonic
1135923057 16:26668446-26668468 AAGTTTTAAAATGCATTTTGAGG + Intergenic
1136714626 16:32268683-32268705 TGGAGAGAAAATGCATAGTGTGG + Intergenic
1137074030 16:35939147-35939169 AGGTTGGAAACTGCATTTTGTGG - Intergenic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1140052317 16:71493008-71493030 AGGTTTTAAAATGCATTTTCAGG - Intronic
1140718930 16:77752892-77752914 TTATGTGAAAATGCCATTTGGGG + Intergenic
1140728384 16:77834358-77834380 TGGTTTGAAAATGCAGTCTCTGG - Intronic
1140756827 16:78075209-78075231 GGATGTGGACATGCATTTTGGGG - Intergenic
1141112968 16:81285433-81285455 TGGTGTGGAAACGGATTCTGAGG + Intronic
1141225369 16:82109932-82109954 TGGTGTGTAAATGCCTTTTGTGG + Intergenic
1141563159 16:84883675-84883697 TGGTCTGGAACTGCATGTTGAGG + Intronic
1203055425 16_KI270728v1_random:921086-921108 TGGAGAGAAAATGCATAGTGTGG - Intergenic
1142918281 17:3161864-3161886 TGGTGTGAAAGTGCTATTTGGGG - Intergenic
1146531283 17:33609634-33609656 TGGAGTTAAGATTCATTTTGGGG + Intronic
1147247597 17:39132495-39132517 GGGTGTGGGAATGCATTTTAGGG + Intronic
1148317009 17:46709955-46709977 TGGTCTGAAAAATTATTTTGTGG + Intronic
1148331489 17:46816666-46816688 TGGTGTGAAATGGTATCTTGGGG - Intronic
1149292264 17:55228766-55228788 TGTTGTGAAGATGCAGTTTAGGG - Intergenic
1149339496 17:55671038-55671060 GGGTGAGAAAATGGATTGTGAGG + Intergenic
1150883335 17:69056960-69056982 TGGTGTGAAAATGCATTTTGGGG + Intronic
1151367558 17:73627264-73627286 TGGAGTCAGAATGTATTTTGTGG + Intronic
1153271394 18:3325903-3325925 TTGTGTGAAACTTCAATTTGGGG - Intergenic
1154197844 18:12279371-12279393 TGGAGTGAAAATTCCTTTTTTGG - Intergenic
1156202175 18:34846204-34846226 TCTTGTGAAAATGCAGTTTCTGG - Intronic
1156842375 18:41624583-41624605 TGGTGAGAAGGTGCACTTTGAGG - Intergenic
1157103408 18:44750473-44750495 GGGTGTTAACATGAATTTTGGGG + Intronic
1157279846 18:46339346-46339368 TTGTTTGAGAATACATTTTGAGG + Intronic
1157833952 18:50881921-50881943 TGATGAGAAAATGCAAATTGGGG + Intronic
1158385082 18:56980322-56980344 TGGTATGCAAATGCAATCTGGGG - Intronic
1158425044 18:57331726-57331748 TATTGTGAATATGCATTTTAGGG - Intergenic
1159798291 18:72868418-72868440 TCGTGTGAAAATCCCTTGTGGGG + Intergenic
1159923168 18:74244726-74244748 GGGTGTGAAATGGCATCTTGTGG + Intergenic
1164948323 19:32314841-32314863 TTGTGAGAAAATTCATTATGTGG - Intergenic
1165703685 19:37958969-37958991 TGGTGTGAAATAGAATCTTGTGG - Intronic
924986618 2:276697-276719 TTGTCTTAAAATGTATTTTGTGG + Intronic
925395304 2:3529300-3529322 TCGTGTGCATATGTATTTTGTGG - Intergenic
926536226 2:14116194-14116216 TGTGGAGAAAATGCATTTAGGGG - Intergenic
927921025 2:26971582-26971604 TGTTGTGAATAAGCATCTTGCGG + Intronic
929140887 2:38665852-38665874 GGAGGTGAAATTGCATTTTGGGG - Intergenic
929303421 2:40332262-40332284 TGTTTAGAAAATGCTTTTTGAGG + Intronic
930707147 2:54515930-54515952 AGGAATGAAAATTCATTTTGGGG - Intronic
932427402 2:71647534-71647556 TTTTCTGAAAATGGATTTTGTGG - Intronic
933786689 2:85848497-85848519 TGGGGTGAAAATGTACTTCGGGG + Intronic
935459228 2:103309239-103309261 TGGGGCGGAAATGTATTTTGAGG + Intergenic
935939087 2:108220013-108220035 AAGTTTTAAAATGCATTTTGGGG - Intergenic
937764447 2:125643372-125643394 AAGCTTGAAAATGCATTTTGAGG - Intergenic
938609913 2:132936885-132936907 TTGTGTGAAAATGATTTATGAGG + Intronic
939719296 2:145627920-145627942 TGGTTTGAGAAGGCATTTTGAGG - Intergenic
939929899 2:148220412-148220434 TCTTGTGAACATGCATTATGTGG + Intronic
941834794 2:170004607-170004629 TGGTTTGAAAAACCACTTTGGGG + Intronic
942112246 2:172693906-172693928 AGGTCTGAAAATGGATCTTGAGG - Intergenic
943343522 2:186709760-186709782 GGGTGTGGAAATGAAATTTGAGG - Intronic
943455071 2:188096267-188096289 TGGTCTGCAAAAGCATTTTTTGG - Intergenic
946596945 2:221316235-221316257 TGGTGTCACAATGGAATTTGAGG - Intergenic
947910195 2:233795700-233795722 TGGTGTGTAGCTGCATTTGGGGG - Exonic
1169094861 20:2888257-2888279 AAGTTTGAAAATGCATTTTCAGG + Intronic
1171047715 20:21826554-21826576 AAGAGAGAAAATGCATTTTGAGG - Intergenic
1172054987 20:32148237-32148259 TTGTTTGAACCTGCATTTTGTGG - Intronic
1173691382 20:44963917-44963939 AGGTGTGAGATTTCATTTTGGGG - Intergenic
1173884006 20:46440792-46440814 TGTTGTGGAAAGTCATTTTGGGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1176961344 21:15162420-15162442 GGGTGTGAAATTTCTTTTTGGGG + Intergenic
1177033955 21:16018644-16018666 TGATGTGCAAATGCACTTAGTGG + Intergenic
1177240264 21:18446630-18446652 TGGGCTGTAAATGCATTTTGGGG - Intronic
1177318461 21:19491658-19491680 GAGTTTTAAAATGCATTTTGAGG - Intergenic
1178177110 21:30115318-30115340 TGGTTTGGAAATGCATCCTGAGG + Intergenic
1178315870 21:31566432-31566454 TCCTCTGAAAATACATTTTGAGG - Intergenic
1179060876 21:37978158-37978180 GGGTGTGAAATTGCATCTTGTGG - Intronic
1179083125 21:38191748-38191770 TGGTATACAAATGCCTTTTGGGG + Intronic
1179396609 21:41045909-41045931 AGGTGGGAAAATGGAATTTGGGG - Intergenic
1179603843 21:42499368-42499390 TGGGCTGAACAAGCATTTTGAGG - Intronic
1180784606 22:18539791-18539813 TGGGGTGAACATGAATTTTAGGG - Intergenic
1181128184 22:20713844-20713866 TGGGGTGAACATGAATTTTAGGG - Intronic
1181241509 22:21479148-21479170 TGGGGTGAACATGAATTTTAGGG - Intergenic
1181272995 22:21671309-21671331 TGGCCTGAAAATGAATTTTTAGG + Intronic
1181590652 22:23882958-23882980 TGGTGTTAAAATGCAGTGAGGGG + Intronic
1181710170 22:24679584-24679606 TGGTGGGAAAATAAGTTTTGGGG + Intergenic
1182201725 22:28578719-28578741 TGGAGAGAAAATGTGTTTTGGGG + Intronic
1184738905 22:46415730-46415752 TGGAGAGAAAATGCATTATTTGG + Intronic
1185276742 22:49953175-49953197 TGGTGTGAAGGTGCCTTTGGAGG + Intergenic
951440317 3:22715249-22715271 TGGTGTGAAAATGAAGAATGAGG - Intergenic
951642349 3:24850228-24850250 TGGTCTGAAAATTCATGTGGTGG - Intergenic
953136308 3:40185293-40185315 TAAAGTGAAAATGCATTTGGGGG - Intronic
954390680 3:50266597-50266619 TGGTAGGAAAATGCCTTTTGCGG + Intergenic
955646094 3:61138761-61138783 TTGTGTGACAATGGATTTAGTGG - Intronic
956929168 3:74023132-74023154 TGCTGTGAAAATGTATAATGGGG - Intergenic
957774500 3:84738586-84738608 TTGTATGAAAGTGCATTTAGAGG + Intergenic
958068768 3:88581716-88581738 CTGTGTGAAAAAGCATTTAGTGG - Intergenic
958532360 3:95349768-95349790 TGGAGTGAAAATAAATTTTATGG + Intergenic
960417141 3:117398485-117398507 TGCTGTGTAAATCCAATTTGTGG - Intergenic
960702045 3:120448995-120449017 TGGTCTGCAACTGCCTTTTGAGG + Intronic
962008251 3:131369546-131369568 TGGTGTGAAAAAGCAAGTTAAGG + Intergenic
962420336 3:135222915-135222937 TGGGGAGAAAATGCATTTGGAGG - Intronic
962565872 3:136658907-136658929 TGGTGTGAAAAGGGAGGTTGTGG - Intronic
962896907 3:139723671-139723693 TTGGATTAAAATGCATTTTGTGG + Intergenic
963544416 3:146637629-146637651 TGAGGTAAACATGCATTTTGAGG - Intergenic
963587074 3:147205527-147205549 TGATGTGAAAATACATTAAGAGG - Intergenic
963950382 3:151193315-151193337 TGATCTGAATATGAATTTTGTGG + Intronic
966950350 3:184811687-184811709 TGGTGTTAAGATGTATTTTGGGG + Intergenic
968357543 3:198120921-198120943 TGCTGTGAAAATGCTTTATTAGG - Intergenic
970080688 4:12281631-12281653 ATGTGTGAAAATGTTTTTTGAGG - Intergenic
970080919 4:12284227-12284249 TTCTGTGAAAATGCTTTTTGAGG - Intergenic
970760979 4:19485980-19486002 CTGTGTGAAAATGAATTTGGGGG + Intergenic
972718283 4:41670824-41670846 TTGTGCGAAAATCCATGTTGGGG + Intronic
973100146 4:46257193-46257215 TGGTGTCAAAACACAATTTGGGG + Intronic
973241461 4:47960205-47960227 AGGTGTGAAAAAGTATCTTGTGG - Intronic
974030000 4:56768305-56768327 TAGTTTGGAAATGCATCTTGTGG + Intergenic
974778566 4:66521434-66521456 TAGTGAGAACATGCTTTTTGTGG - Intergenic
975578712 4:75888063-75888085 TGGAGTGAATATGCAAATTGTGG + Intronic
975960278 4:79895477-79895499 TGGTGTAGAACTGGATTTTGGGG + Intergenic
977987920 4:103406486-103406508 CTGTGTGAAAATACCTTTTGTGG + Intergenic
979077626 4:116294138-116294160 CTTTGAGAAAATGCATTTTGTGG - Intergenic
979204091 4:118013974-118013996 TGGTGTTAAGATTCATTATGAGG - Intergenic
980222619 4:129939356-129939378 AAGTTTGAAAATGCAGTTTGAGG - Intergenic
980934639 4:139214608-139214630 TATTTTGAAAATGGATTTTGAGG + Intergenic
982112495 4:152069965-152069987 TGGAGAGAAAAGCCATTTTGTGG - Intergenic
982547779 4:156757138-156757160 TGGTGTGCAAATGCTTTCTGAGG + Intergenic
982635532 4:157891766-157891788 TTGTGTGAACATTCATATTGAGG - Intergenic
983801520 4:171935808-171935830 AGGTGTGTAGATGAATTTTGTGG + Intronic
984496837 4:180508847-180508869 TTCTGAGAAAATGCATCTTGAGG + Intergenic
986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG + Intergenic
986370173 5:7072299-7072321 TTCTTTGAAAATTCATTTTGTGG + Intergenic
987199924 5:15566572-15566594 TAATGCGAAAATGAATTTTGGGG + Intronic
987280176 5:16405951-16405973 TGGTATGACAATACCTTTTGAGG - Intergenic
987687120 5:21219211-21219233 TGGTGTGGAACTCCATTATGAGG + Intergenic
988171879 5:27668876-27668898 TGCTGTGAAAAAGCTTTTTACGG + Intergenic
988366536 5:30307930-30307952 TGATGTGAGAATGTATTTTTTGG - Intergenic
988813923 5:34812785-34812807 TGGTGTGAAAATGTTTGATGTGG + Intronic
990552654 5:56899501-56899523 TTGTGGGAAAAAGAATTTTGGGG - Intergenic
990594011 5:57294977-57294999 TGGTGGGAATATGCATCTTTTGG + Intergenic
993390396 5:87313865-87313887 AGGTCTGAAAATGCATGTTTGGG + Intronic
993426605 5:87772705-87772727 TTGTGGGAAATTGCAATTTGGGG + Intergenic
993714935 5:91266873-91266895 AGGTGTGTAAATACATTTTCAGG - Intergenic
993973459 5:94447982-94448004 TGGTTTAAAAAAGCATTTTCAGG - Intronic
994992340 5:107012999-107013021 TGGTGTGAAAATGTGTTTTGTGG + Intergenic
995552204 5:113293074-113293096 CGGTTTGAAATAGCATTTTGAGG - Intronic
996209535 5:120789553-120789575 TGTTGTGAAAATGCACTTTGTGG + Intergenic
996275481 5:121660859-121660881 TGGTGTGGATATCCTTTTTGTGG - Intergenic
996495546 5:124150991-124151013 TGGTGTGAAATGGTATCTTGTGG - Intergenic
996522563 5:124443258-124443280 TTCAGTGAAAATGCATTTTCTGG - Intergenic
998016098 5:138733634-138733656 TGGTCAGGAAAGGCATTTTGAGG + Intronic
998484899 5:142493426-142493448 TGGTGATAACATGCATTTTGAGG + Intergenic
999175657 5:149630057-149630079 TGGTGTGAAGTTTCTTTTTGGGG + Intronic
1000679592 5:164166654-164166676 TGTTTTAAAAATGCATTTTAGGG - Intergenic
1000954784 5:167530504-167530526 TTGTGAGAAAATCCACTTTGGGG - Intronic
1001353447 5:170996872-170996894 TGGAGTCAAAATGCAGTTTTGGG - Intronic
1001890521 5:175334283-175334305 TGCTTTGAAAATGAATGTTGGGG + Intergenic
1002071897 5:176683772-176683794 AGGTTTGAAGCTGCATTTTGTGG - Intergenic
1002665905 5:180824713-180824735 GGGTGTGAATATCCATTCTGAGG - Intergenic
1003702664 6:8486754-8486776 TGGTGCTCAACTGCATTTTGGGG + Intergenic
1004258920 6:14090414-14090436 AGGTGAGAAAGTTCATTTTGAGG + Intergenic
1004495821 6:16161463-16161485 TGGTGGGAAGATGGATTTGGAGG + Intergenic
1005210907 6:23461162-23461184 AAGTATGAATATGCATTTTGTGG - Intergenic
1005526261 6:26653208-26653230 AGGCATGACAATGCATTTTGCGG + Intronic
1005589515 6:27310110-27310132 TGGTGGGAAAATGAATCCTGTGG + Exonic
1005623232 6:27639099-27639121 CAGTGTGAAAATGCAGTTTCAGG - Intergenic
1007316444 6:40993081-40993103 TGGTGTTCAAACGCATTTAGGGG - Intergenic
1007751932 6:44076260-44076282 TGGTGGGAACAGGCCTTTTGAGG + Intergenic
1007958223 6:45936115-45936137 TGGTATAAAAATGCAGTTTGAGG - Intronic
1007971214 6:46054096-46054118 TCTTGTGAAAAATCATTTTGAGG - Intronic
1008269937 6:49479878-49479900 TTGTGAGAAAATGCACTATGTGG - Intronic
1008797372 6:55320710-55320732 TGCTGTAAAAGGGCATTTTGTGG + Intergenic
1008801758 6:55377198-55377220 TGGTGAGAAACTGCCTATTGGGG - Intronic
1009718532 6:67431667-67431689 TGGATTTAAAAAGCATTTTGTGG + Intergenic
1010789128 6:80044413-80044435 TGTTTTGAAAATACATTTTTAGG + Intergenic
1010940179 6:81907488-81907510 AGGTGAGAAAATGCAATTTTTGG + Intergenic
1011357043 6:86481908-86481930 AGGCATGAAAATGCATGTTGCGG + Intergenic
1011669033 6:89664502-89664524 TGATGGGAAAATGCATGATGGGG - Exonic
1011735101 6:90302689-90302711 TGCTTTGAAAAGGCAATTTGGGG - Intergenic
1012248196 6:96950899-96950921 TAGTGAGAAAATGCAATTTTGGG + Intronic
1013440844 6:110166357-110166379 TGGTGTGAAAATGTAATTTGGGG - Intronic
1014366781 6:120553392-120553414 TGTTGTGATAATACATTTGGTGG + Intergenic
1016791580 6:148071890-148071912 TGGTGTGAAATGGCATCTTATGG + Intergenic
1017053609 6:150418029-150418051 CGGTGTCAAAATGCGTATTGTGG - Intergenic
1018096906 6:160395890-160395912 TGGTTGGAATATGAATTTTGAGG - Intronic
1018241640 6:161781525-161781547 TGTTGTTAAAATGCATTATATGG - Intronic
1018317808 6:162574380-162574402 AAGTTTTAAAATGCATTTTGAGG + Intronic
1018882458 6:167898342-167898364 TGGCATGAAAGTGCAGTTTGGGG + Exonic
1019121350 6:169807652-169807674 TGGTGTGAAAAACCGTGTTGTGG - Intergenic
1019363376 7:617503-617525 TGGTGTGCAAATGCATGTGTTGG + Intronic
1021074924 7:16290725-16290747 TGGTGTCAAAAAGCATTTTATGG + Intronic
1021639708 7:22725666-22725688 TGGTGTGAAAATGAAAATGGGGG - Intergenic
1021763164 7:23921170-23921192 TGGTGAGGAAATGAATTTTCAGG + Intergenic
1021788095 7:24172670-24172692 TGGGGAGAAAATTCATTTGGGGG - Intergenic
1021911267 7:25387667-25387689 TGTGGTGAAAATGGATTATGTGG + Intergenic
1022141587 7:27497701-27497723 TGGTATTAAAAAACATTTTGGGG + Intergenic
1023713789 7:43022346-43022368 GGGTGTTAAAATGCACTCTGAGG + Intergenic
1024364932 7:48509754-48509776 AGGTGTCAACATGAATTTTGGGG - Intronic
1024938788 7:54740630-54740652 TGTTGTGAAAATAAATCTTGGGG + Intergenic
1027419301 7:78004319-78004341 CGGAGTGAAAATGTGTTTTGGGG + Intergenic
1027543792 7:79501057-79501079 TGGTGGGAAAATACATGATGTGG - Intergenic
1028390330 7:90309317-90309339 TGGTGAAATATTGCATTTTGTGG - Exonic
1028665048 7:93332434-93332456 GGGTGTCAACATGCATTTTGAGG + Intronic
1030802974 7:113876758-113876780 TGTTTTCTAAATGCATTTTGGGG + Exonic
1030885368 7:114929972-114929994 TGATGTGAAAATGAATATTGAGG + Intronic
1031093340 7:117389381-117389403 AAGTTTTAAAATGCATTTTGAGG - Intronic
1034525887 7:151662050-151662072 TTGTGTGAAAATGCATTTGGGGG - Intronic
1035528113 8:330162-330184 TGCTGTGAAAGTGTATTGTGGGG - Intergenic
1040558617 8:48503809-48503831 TGGTCTGAACATCCATTTTTGGG + Intergenic
1041150273 8:54925539-54925561 TGGAGTGAAAGTTCATTATGTGG - Intergenic
1041682801 8:60610049-60610071 TGGTTTGAAAAGGCCTTTTTAGG + Intronic
1042518623 8:69685972-69685994 TGGTGTGAATGTGATTTTTGAGG - Intronic
1042883474 8:73521069-73521091 TGTTGTGATAATGTATATTGGGG + Intronic
1043224858 8:77713315-77713337 TGGGGTGGAAATAAATTTTGGGG - Intergenic
1043776903 8:84280836-84280858 CCGTGTGAAAATACATTTTTGGG + Intronic
1045524887 8:102933239-102933261 TGGTGTGAAAGTGGGCTTTGGGG - Intronic
1046357419 8:113106987-113107009 AGGTGTGAGATTTCATTTTGGGG - Intronic
1046573927 8:116001330-116001352 TGGTTTAAAAAAACATTTTGGGG - Intergenic
1047281032 8:123445904-123445926 TGGTTTCAAAATTCATCTTGGGG - Intronic
1047906797 8:129481170-129481192 GGATGTCAAAATGAATTTTGGGG - Intergenic
1048592838 8:135837493-135837515 TGGGCTGAAAATGCATCTTCAGG - Intergenic
1050124667 9:2344319-2344341 GGGTGTGCACATGCAGTTTGGGG + Intergenic
1050541008 9:6670108-6670130 TTGTGTTAAAATGCTCTTTGCGG - Intergenic
1051053465 9:12956756-12956778 AGATGAGAACATGCATTTTGAGG + Intergenic
1052270755 9:26625867-26625889 TGGTTTGCAAATGCATTTGTAGG - Intergenic
1054784742 9:69200040-69200062 TGAGGTGAATATGCATTTTAAGG + Intronic
1055310791 9:74977494-74977516 TGCTGTGATAATGTAGTTTGTGG + Intergenic
1055408814 9:76005007-76005029 TGGTATGGAATTGCATTTGGAGG - Intronic
1058741290 9:107945143-107945165 TGGTGTCAAAATCCAATTTATGG - Intergenic
1059074343 9:111176239-111176261 TGGTGGGAAACTGCATATTGTGG - Intergenic
1060214046 9:121727669-121727691 TGGTGAGAAAAGGAATGTTGGGG + Intronic
1062725014 9:138067855-138067877 TTGTGTGAAAATGCCTCTGGGGG - Intronic
1185916070 X:4036842-4036864 AGGTGGGAAAATGCATGTAGGGG - Intergenic
1187010581 X:15274317-15274339 AAGTTTTAAAATGCATTTTGAGG + Intergenic
1187658566 X:21510953-21510975 TTGTGTAAAAATGCATATGGTGG + Intronic
1187897212 X:23993565-23993587 TTGTGTGTTAATGCATTTGGGGG + Intronic
1188316356 X:28678500-28678522 AAGTTTTAAAATGCATTTTGAGG + Intronic
1188351124 X:29132000-29132022 TGATGTCAAAATTCATTTGGGGG + Intronic
1188516457 X:30992565-30992587 TGCTTTGAAAATGCACATTGTGG - Intergenic
1192991842 X:76467687-76467709 TGGTGTGAGATTGGCTTTTGGGG - Intergenic
1194461605 X:94176569-94176591 AAGTTTTAAAATGCATTTTGGGG - Intergenic
1194469535 X:94275581-94275603 AACTGTGAAAATGCATTTTATGG + Intergenic
1194782142 X:98036963-98036985 TGCTTTAAAAATGCTTTTTGGGG - Intergenic
1195145836 X:102016434-102016456 TTGTGTGATACTGCCTTTTGTGG + Intergenic
1195311265 X:103633921-103633943 TGGTGTGAAGATGCTTTTTAAGG + Intergenic
1195314711 X:103666232-103666254 TGGTATGAAGATGCTTTTTAAGG + Intergenic
1195799752 X:108694661-108694683 AGGTGAAAAAATGCACTTTGAGG - Intronic
1195805057 X:108755983-108756005 TTGTGAGAAAATGCATTGTTAGG + Intergenic
1196064726 X:111451095-111451117 TGGTGTGAAATTGTATCTTGTGG - Intergenic
1196189518 X:112780199-112780221 TGGTTAGAATAAGCATTTTGGGG - Intronic
1197161584 X:123329176-123329198 TGGTATGAAATATCATTTTGTGG - Intronic
1197382242 X:125759040-125759062 TGGTGCCAAAATGTATATTGGGG - Intergenic
1198729266 X:139710543-139710565 TGGTGAGAACATTCAGTTTGAGG + Intergenic
1200006196 X:153086358-153086380 TGGAGTTAAATTGCATTTTATGG + Intergenic
1200355428 X:155544888-155544910 TGGTCTGAAAATACTTTTTGTGG - Intronic