ID: 1150886748

View in Genome Browser
Species Human (GRCh38)
Location 17:69095480-69095502
Sequence AATTTCTTGTAGAAGTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150886743_1150886748 3 Left 1150886743 17:69095454-69095476 CCTGCTGGCCAAAAGAGTCCCAG 0: 1
1: 0
2: 0
3: 16
4: 151
Right 1150886748 17:69095480-69095502 AATTTCTTGTAGAAGTCAGTGGG 0: 1
1: 1
2: 1
3: 21
4: 261
1150886744_1150886748 -5 Left 1150886744 17:69095462-69095484 CCAAAAGAGTCCCAGACTAATTT 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1150886748 17:69095480-69095502 AATTTCTTGTAGAAGTCAGTGGG 0: 1
1: 1
2: 1
3: 21
4: 261
1150886741_1150886748 26 Left 1150886741 17:69095431-69095453 CCACTGAGAAGGAACAACAGCTA 0: 1
1: 1
2: 2
3: 13
4: 183
Right 1150886748 17:69095480-69095502 AATTTCTTGTAGAAGTCAGTGGG 0: 1
1: 1
2: 1
3: 21
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150886748 Original CRISPR AATTTCTTGTAGAAGTCAGT GGG Intronic
901235907 1:7667528-7667550 AATGTCTTGCAGAAGCCAGGAGG + Intronic
901273730 1:7974139-7974161 ATTTTTTTGTAGAGGTCGGTGGG - Intronic
901299489 1:8189115-8189137 AATTTTTTGTAGAGGTTGGTGGG + Intergenic
901512676 1:9725245-9725267 AATATCTTTTAGAAGGCAGAGGG - Intronic
904935266 1:34125794-34125816 AATTCCTTCCAGAAGACAGTGGG - Intronic
906190166 1:43893716-43893738 AAGTTCTTGTGGAAGTGAGGAGG - Intronic
907283625 1:53366887-53366909 AATTCTTTGTAGATGTCATTAGG - Intergenic
907713590 1:56907213-56907235 CATTTCCTGAACAAGTCAGTTGG + Intronic
908969817 1:69814516-69814538 CATTTCTTGTTGAATTCAGAGGG - Intronic
909084613 1:71155906-71155928 AATATCAGGTAGAAGTTAGTTGG - Intergenic
909404005 1:75265861-75265883 AAGTTTTTGTAGTAGCCAGTAGG + Intronic
910147757 1:84102602-84102624 AATTTCTTTTAAAACTCTGTGGG - Intronic
910272473 1:85411496-85411518 AATTTGGTGTAGAAGACAGAAGG - Intronic
910446156 1:87300545-87300567 GATTTCTTGTAACAGTGAGTGGG - Intergenic
910685088 1:89907821-89907843 AATCTCTTGAAGAAATCAGTTGG - Intronic
911636452 1:100241294-100241316 AATCTCTTATAGAAATAAGTAGG + Intronic
912276907 1:108268545-108268567 AATTTCTTGTAGGGGTGGGTGGG + Intergenic
912291322 1:108425811-108425833 AATTTCTTGTAGGGGTGGGTGGG - Intronic
912689548 1:111794254-111794276 AATTAATTGTACAAGTCAGGTGG - Intronic
913518957 1:119627812-119627834 GATTTCTTGTCTAAGACAGTAGG + Intronic
916523409 1:165586485-165586507 ACTTTCTTTTAGAAGGCAGGAGG + Intergenic
918120789 1:181538032-181538054 AAGATCTTGTAGAAGTTAGTTGG + Intronic
919156218 1:193769227-193769249 ACTTTCTTGGAGAATTTAGTAGG + Intergenic
921542996 1:216441250-216441272 AATTTCTTGGCAAAGTCATTTGG - Intergenic
921625966 1:217378289-217378311 AATAACTTGTAGAAATCTGTTGG + Intergenic
923128306 1:231052155-231052177 GATTTATTGTAGAATTCAGTTGG - Intergenic
923128481 1:231054141-231054163 GATTTATTGTAGAATTCAGTTGG - Intergenic
923977442 1:239279363-239279385 AAATTTTGGTAGAAGTCATTTGG - Intergenic
1063700295 10:8377988-8378010 AATTCCTTGTAGGATTCAGATGG + Intergenic
1065355555 10:24837320-24837342 AATGTCTGGTAGAATTCAGCTGG - Intergenic
1065976082 10:30843449-30843471 TATTCTTTGTAGAAGTCATTTGG + Intronic
1068380254 10:56244745-56244767 AATTTATTCTAGAAGCCACTTGG - Intergenic
1068957658 10:62833815-62833837 AAATTCTTGTAGCTTTCAGTTGG - Intronic
1070324219 10:75377315-75377337 AGTTTCTTATAGAGCTCAGTGGG + Intergenic
1070527248 10:77305920-77305942 AATTTATAGTGGAAATCAGTGGG - Intronic
1070993770 10:80756744-80756766 TATTTCTTGTAGAAGACTGGAGG - Intergenic
1073898330 10:108188865-108188887 AATGTTTGGTAGAATTCAGTAGG - Intergenic
1073947494 10:108767755-108767777 AATTGCTTGTCTAAGCCAGTGGG - Intergenic
1075004729 10:118821652-118821674 ACATTCTTGTACAAGTCATTTGG - Intergenic
1076367075 10:129927999-129928021 CATTTCTGGTAGCAGACAGTGGG - Intronic
1077075698 11:700943-700965 CATGTCTTGTAGAAGCCACTGGG + Intronic
1078261016 11:9708865-9708887 AACTGCTTGTAGAACTCAGTAGG - Intronic
1080347279 11:31339125-31339147 AAGTTCATGTTTAAGTCAGTTGG + Intronic
1080790102 11:35514827-35514849 AATTTTTTGTAGAAACCAGGGGG - Intronic
1081415795 11:42813828-42813850 AATGTGTTGTTGAATTCAGTTGG - Intergenic
1081532979 11:43976896-43976918 AATATCTTGTATGAGTGAGTAGG + Intergenic
1082639013 11:55631758-55631780 AATGTTTTATAGATGTCAGTTGG - Intergenic
1088187620 11:107190125-107190147 AATACATTGTTGAAGTCAGTTGG + Intergenic
1089773322 11:120818627-120818649 AATTTTTGGGAGAAGTCAGCTGG - Intronic
1090454197 11:126833601-126833623 AATTTCTTTATGAAGACAGTTGG + Intronic
1092867446 12:12776140-12776162 TATTTTTAGTAGAATTCAGTCGG - Intronic
1093565525 12:20598478-20598500 AATGTATTTTAAAAGTCAGTAGG - Intronic
1094328536 12:29267625-29267647 AAATTCTTGAGGAAGTCACTGGG + Intronic
1094726614 12:33125257-33125279 AATATTTTGAAGATGTCAGTGGG + Intergenic
1094824466 12:34258591-34258613 ACTTTTTTGGAGAACTCAGTGGG - Intergenic
1095725568 12:45448049-45448071 CATTTCTTGTAGTGCTCAGTTGG - Intergenic
1098160023 12:67640958-67640980 AAATCCTTCTAGAAGTCAGTGGG + Intergenic
1099391900 12:82091778-82091800 AATTTATTGTAGAATCCAGGAGG - Intergenic
1099399945 12:82191925-82191947 AATTTCTTGGTGAAATCTGTAGG - Intergenic
1101448885 12:104758292-104758314 AATTTCTGCTAGAAATAAGTAGG + Exonic
1101797694 12:107990972-107990994 AATTACCTGAAGAAGTAAGTTGG + Intergenic
1104811832 12:131624059-131624081 ACCTGCTTGGAGAAGTCAGTCGG - Intergenic
1105061255 12:133153321-133153343 AAGTTATTGTCGAAGTCTGTTGG - Intronic
1105741821 13:23333179-23333201 AATTTCTTAAAGAAATCATTAGG + Exonic
1108938151 13:55912320-55912342 TATTTCTTTTAGAAATCTGTGGG + Intergenic
1109427768 13:62189539-62189561 AATGTGTTGTTGAATTCAGTTGG - Intergenic
1109755328 13:66751293-66751315 AATTTCTCTTTGAAGTCATTGGG - Intronic
1111599284 13:90451281-90451303 AGATTCTTGCAGAGGTCAGTAGG + Intergenic
1111774279 13:92639918-92639940 AATTTCTAGAAGCAGTGAGTAGG - Intronic
1112479713 13:99763875-99763897 AATGTGTTGTTGAAGTCAGTTGG + Intronic
1114327436 14:21603245-21603267 AGTTTCTTGTAGATCTCAGGAGG - Intergenic
1115857641 14:37648143-37648165 AATTTCTTGTTTAATACAGTTGG + Intronic
1118577324 14:67255989-67256011 AATTACTTATTAAAGTCAGTTGG - Intronic
1121723138 14:96126065-96126087 ATTTTCTTGTAGAAATGAGCTGG - Intergenic
1121884003 14:97526099-97526121 AATATCTTGTATGTGTCAGTAGG - Intergenic
1122475403 14:102004953-102004975 AATCTATAGTAGAAGTGAGTGGG + Intronic
1123792451 15:23735882-23735904 AATTTATTGTTATAGTCAGTAGG + Intergenic
1125217990 15:37299935-37299957 ATTTTCTTGTAAAAGACATTTGG + Intergenic
1126426378 15:48530923-48530945 TATTTCTGGAAGAAGTCCGTTGG - Intronic
1126816080 15:52455574-52455596 AATGTGTTGTTGAATTCAGTTGG - Intronic
1128853144 15:70982553-70982575 AATTTTGTGTACAATTCAGTGGG - Intronic
1128905072 15:71460214-71460236 AATTTCTTCTATTAGTGAGTCGG - Intronic
1132191183 15:99862513-99862535 AATTTCTAGAAGAAGTGAGTAGG + Intergenic
1134140573 16:11714723-11714745 ATTTGCTTGTAGAACTGAGTCGG - Intronic
1134690787 16:16189998-16190020 TAGTTCTTGTAGAAGACAGCAGG + Intronic
1135220129 16:20607228-20607250 AGTTTGTTCTACAAGTCAGTAGG - Intergenic
1138671084 16:58615127-58615149 AATATCTTCTAGAGGTAAGTGGG + Intronic
1139019541 16:62730199-62730221 AATTTCTAAAAGAAGTTAGTAGG + Intergenic
1140703041 16:77600125-77600147 TTTTTCTTTTAGCAGTCAGTTGG - Intergenic
1150886748 17:69095480-69095502 AATTTCTTGTAGAAGTCAGTGGG + Intronic
1151364015 17:73605473-73605495 CATGTCTTGGAGAAGGCAGTTGG + Intronic
1154230910 18:12555432-12555454 AATGTGTTGTTGAATTCAGTTGG - Intronic
1155761879 18:29577923-29577945 AATTTCTTTTTGAAAGCAGTAGG + Intergenic
1158062180 18:53358374-53358396 AATTTCTTGTAATAGATAGTAGG + Intronic
1159928754 18:74291738-74291760 AATTTCTGGAAGAGGTGAGTTGG - Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166437499 19:42780969-42780991 AATCACTTGTAGGAGACAGTGGG + Intronic
1166563984 19:43752362-43752384 AACTGTTTGTAGAACTCAGTGGG + Intronic
925739147 2:6990065-6990087 AATTTCCTATGGTAGTCAGTTGG + Intronic
926800478 2:16655736-16655758 AATTTTATGTAATAGTCAGTTGG - Intronic
927007790 2:18868141-18868163 AATTTCCTTTAGAAGTCTGATGG + Intergenic
928630081 2:33182325-33182347 AATACCTTGTAAAAGTCAATTGG + Intronic
929072121 2:38041987-38042009 AATCTCTTGTAGAATACAGAAGG - Intronic
930451720 2:51547617-51547639 AATTTCTTCTAGAATTCTGGGGG + Intergenic
930474611 2:51865416-51865438 CCTTTCTTGTAGAAGTGAGGTGG + Intergenic
930482631 2:51968080-51968102 AATTTCTTGTAAAAGGGAGATGG + Intergenic
932023029 2:68107446-68107468 AATTTGTTATAGAACTCACTAGG - Intronic
932695677 2:73954168-73954190 AATTTTTTGTAGAGGGCAGGGGG - Intronic
933173687 2:79154379-79154401 CATTTCTGGAAGATGTCAGTGGG + Intergenic
936493433 2:112996007-112996029 ATTTCATTGTAGAAGACAGTTGG + Intergenic
937922931 2:127144935-127144957 TAATTCTTCTAGAAGACAGTTGG - Intergenic
938252304 2:129825454-129825476 AATTCCTTCTAGAATTCATTTGG - Intergenic
939316496 2:140557231-140557253 AATTTCTTGAATAAGACATTTGG + Intronic
939698269 2:145356233-145356255 CATTTCCTGTAGAAGTCTTTTGG + Intergenic
940611818 2:156002865-156002887 TATCTCTTGTAAAAGTCAGGAGG + Intergenic
941405440 2:165081545-165081567 AATTTCTTTTCTAAGTTAGTTGG - Intergenic
942073298 2:172334791-172334813 AATTCCTTTTAAAAGGCAGTTGG + Intergenic
943043537 2:182831211-182831233 AATTTCTTGCAGAAGGCAATAGG + Intergenic
944286599 2:197957154-197957176 AATTCCTAGTGGAAGTGAGTTGG - Intronic
944787466 2:203087746-203087768 AGTATCTTTTAGAAGTCTGTGGG + Intronic
945826916 2:214732175-214732197 AATTTACTGTTGAAGTAAGTAGG - Intronic
946750355 2:222888990-222889012 AATTTCTTTTAGTAGTTAATGGG + Intronic
947055441 2:226095179-226095201 TATGTCTTGTAGAATTTAGTTGG - Intergenic
947405525 2:229772401-229772423 AATTCCTTTTAGTATTCAGTAGG - Intronic
949083519 2:242126174-242126196 AATCCCTTTTAGAAGTCAATCGG - Intergenic
949083531 2:242126258-242126280 AATCCCTTTTAGAAGTCAATCGG - Intergenic
1168785783 20:539189-539211 ATTATCTTACAGAAGTCAGTGGG + Intronic
1171107038 20:22444052-22444074 ATTGTCTTGTTGAAGTCACTGGG + Intergenic
1172795910 20:37537405-37537427 TATTTCTTGGAGAAGCCAGATGG + Intergenic
1173091985 20:39981628-39981650 AATTTCTTGGATAAGATAGTTGG + Intergenic
1173438568 20:43055069-43055091 AATTGCTTGTAGTAATTAGTGGG - Intronic
1174936194 20:54872532-54872554 ATTTTCTTTTGGAAGTAAGTGGG + Intergenic
1175009504 20:55720871-55720893 CATTTCCTTTTGAAGTCAGTTGG - Intergenic
1178186955 21:30233381-30233403 AACTTCTTGTAAAAGTCAGTAGG + Intergenic
1179841177 21:44074933-44074955 AATTTCTTCTAGAATTTAGCTGG + Intronic
1180115021 21:45697170-45697192 AATTTCTTATAGATATCATTTGG - Intronic
1181348665 22:22239597-22239619 AAATTCTTACACAAGTCAGTTGG - Intergenic
1184199622 22:42958525-42958547 AAATTCATGCAGAATTCAGTAGG + Intronic
1185394496 22:50579726-50579748 ATTTGCTGGTAGAAGTCAGTCGG - Exonic
949151650 3:775524-775546 AATTTCTGTTGGAAATCAGTAGG - Intergenic
949293258 3:2490269-2490291 AGTTTCTTGCAGAAAGCAGTAGG - Intronic
951307892 3:21087848-21087870 AATTTTTGGTGGAATTCAGTAGG - Intergenic
952506639 3:34012748-34012770 AATTTCATGTAGAAGTCAAATGG + Intergenic
953941777 3:47105623-47105645 AATATATTTTAGAAATCAGTCGG + Intronic
956212301 3:66814454-66814476 AATCTCTTGTAGACACCAGTGGG + Intergenic
956676793 3:71741671-71741693 AATGTTTTGTAAATGTCAGTTGG - Intronic
956867145 3:73380992-73381014 AATTTCTTTTAGAAGTTAATCGG + Intergenic
958464123 3:94437698-94437720 AATTTATTGTAGAAGTCAGTTGG - Intergenic
959205510 3:103301774-103301796 TATTTCTGGTAGAATTCAGCTGG + Intergenic
960354650 3:116636437-116636459 CATTTCTTGAAGATGTCAGGAGG + Intronic
960792188 3:121445197-121445219 AATTTTTGGTAGAATTCAGCAGG + Intronic
961215107 3:125153596-125153618 ATTATCTCTTAGAAGTCAGTGGG - Intronic
961608631 3:128118062-128118084 AATTTCTTCTAGAAGTTTGTTGG - Intronic
961630932 3:128297887-128297909 AAGTACTTGGAGAAGTCAGCAGG - Intronic
962957598 3:140280406-140280428 AATTACTGGTAGAAGAGAGTAGG + Intronic
963292832 3:143510944-143510966 AATTTCTTGGAGAAGTGAACAGG - Intronic
964519281 3:157545636-157545658 ACTTTCTTGTTTATGTCAGTTGG - Intronic
964618360 3:158694745-158694767 AAGTTCTTTTGAAAGTCAGTTGG - Intergenic
964973409 3:162588815-162588837 AATTCCTTCTAGAAACCAGTAGG + Intergenic
966906894 3:184532718-184532740 AATTTCTTCCAAAAGTTAGTAGG + Intronic
967579250 3:191132943-191132965 AACTTTTTTTGGAAGTCAGTAGG - Intergenic
971907221 4:32742663-32742685 CATTACTTGTACAAGTTAGTGGG - Intergenic
973166171 4:47080084-47080106 AATGTCTAGTTGAAGCCAGTTGG - Intronic
974223476 4:59007051-59007073 AATTTATTGTAGATCTCAGCAGG - Intergenic
975060214 4:69987922-69987944 AATGTCTTGTAGAATTTAGATGG + Intergenic
975296858 4:72744573-72744595 TATTTCTTGCCCAAGTCAGTTGG - Intergenic
975771775 4:77732117-77732139 ACTTTCTAGTAAAAGTCAGATGG - Intronic
976075386 4:81292697-81292719 AATTTATAATAGATGTCAGTGGG - Intergenic
977305795 4:95322076-95322098 AATTTTTTATTTAAGTCAGTGGG - Intronic
978834185 4:113128013-113128035 AATTTCATGTGCAAGTCAGAAGG + Intronic
981268260 4:142813418-142813440 GTTTACTTGTAGGAGTCAGTTGG + Intronic
981359973 4:143835094-143835116 AATTTCTCATATGAGTCAGTGGG - Intergenic
983730621 4:170989350-170989372 AATATTTTGTAGATGTCTGTTGG + Intergenic
983746892 4:171212167-171212189 AATTTCTTGTTGGAGTCATTAGG + Intergenic
986096422 5:4558685-4558707 ACTTTCTAGTAGAATTCTGTAGG - Intergenic
986266159 5:6193175-6193197 CATTTTTTGTAGAAGGGAGTCGG - Intergenic
986487061 5:8248413-8248435 AATGGCTTGTAGAAGAGAGTAGG + Intergenic
987627604 5:20422859-20422881 AATTTATAGCAGAAGTCAGAAGG + Intronic
987783954 5:22474434-22474456 CATTTCTTTCAGAACTCAGTTGG - Intronic
987950334 5:24666254-24666276 GATTTCTTCTAAAAGTCAGTGGG - Intergenic
988328700 5:29806193-29806215 TATTTCTTGTTGAAGTCTGAAGG - Intergenic
989066748 5:37470778-37470800 ACATTCTTGTAGATGTCATTTGG + Intronic
989548537 5:42703931-42703953 AATTTTTTGTTGAAGTCTTTAGG + Intronic
989735855 5:44704766-44704788 AATTTTTTTTAAAAGCCAGTTGG - Intergenic
990841175 5:60080971-60080993 TATTTCTGGTAGAATTCAGCTGG + Intronic
991962155 5:72055762-72055784 AATTTCTTGGAGAAGAGAGCAGG - Intergenic
993667148 5:90713408-90713430 ATTTTCTTGTAGAACATAGTGGG + Intronic
993691898 5:91012176-91012198 AATTTTGTTTAGAAGTAAGTAGG - Intronic
994925955 5:106117652-106117674 AATTGCTTGTATAATTCTGTTGG - Intergenic
995046987 5:107661784-107661806 TATATTTTGTAGATGTCAGTGGG - Intronic
996090879 5:119350735-119350757 AATTTATGGGAGAAGTCACTGGG + Intronic
998667060 5:144309416-144309438 AATTGCTTGTAAAACTCAGGCGG + Intronic
999859250 5:155627846-155627868 ATTTTCCTGTAGAAGGCACTTGG - Intergenic
1000094706 5:157961121-157961143 AAGTTCGTGTAGGAGTCAGAAGG - Intergenic
1000265986 5:159638208-159638230 AATGTTTAGTAGAATTCAGTAGG - Intergenic
1000745688 5:165030699-165030721 AATTTCTTGCACAACTGAGTAGG - Intergenic
1002159494 5:177306932-177306954 AAATACTTGTTGAATTCAGTTGG + Exonic
1003008896 6:2408237-2408259 CATTTCTTCTAGAAGTCACCTGG + Intergenic
1003734663 6:8865039-8865061 TATTTCGTGTAGAAGGCACTTGG + Intergenic
1004070373 6:12291991-12292013 AGTTCCTTGTAGAAGCCAGCCGG + Intronic
1004182341 6:13391934-13391956 AGTTACTTGTAGTAGACAGTTGG + Intronic
1006689990 6:35875018-35875040 ACTTGCATGTAGAAGCCAGTGGG - Intronic
1007152213 6:39704988-39705010 AATTTATTTTAGAAATAAGTGGG + Intronic
1009397338 6:63214588-63214610 TATTCCTTTTAGCAGTCAGTGGG - Intergenic
1009685053 6:66945717-66945739 AATGTCTTCTAGGAGTCATTAGG + Intergenic
1011132910 6:84070702-84070724 AATTACTTATAGAACTAAGTGGG - Intronic
1011332987 6:86230802-86230824 AATGTTTGGTAGAATTCAGTAGG + Intergenic
1012153529 6:95786662-95786684 TACTTCATGTACAAGTCAGTTGG - Intergenic
1012198795 6:96378859-96378881 AATTTCTTGGAGAATGCAGCAGG + Intergenic
1012309412 6:97703207-97703229 AATTGCTTGTATACTTCAGTAGG + Intergenic
1014462296 6:121710962-121710984 AATTTCTGCAAAAAGTCAGTAGG - Intergenic
1015318163 6:131841214-131841236 AATATCTTGTAGAAGTTTCTTGG + Intronic
1016021340 6:139239234-139239256 AAATTCTTGGAGCAGTCAGGAGG + Intergenic
1017014305 6:150087843-150087865 AATTTCTTTTAGAAGTCATAGGG - Intergenic
1017150586 6:151275561-151275583 ATTTTGTTGTAGAAGACATTTGG + Intronic
1018214111 6:161510060-161510082 AATTTCTTATAGAAATCATAAGG - Intronic
1018407296 6:163500614-163500636 AATTTCCTGTAAAATTCTGTAGG - Intronic
1022273250 7:28831043-28831065 AATCTCTTGCAGAAGCCAGCTGG - Intergenic
1026090925 7:67300379-67300401 AATTTCATGTAGTAGGAAGTGGG - Intergenic
1027709243 7:81577276-81577298 ATTTTATTGTAAAAGTCATTAGG - Intergenic
1027784221 7:82558943-82558965 AATTTCTTTTAAAAGCCAGGGGG - Intergenic
1028108002 7:86902908-86902930 ATATTCTTGTAGAAGACACTGGG - Intronic
1028882426 7:95894815-95894837 AGATGCTTGAAGAAGTCAGTTGG + Intronic
1030811901 7:113982862-113982884 AATTTCACATAAAAGTCAGTAGG - Intronic
1031442061 7:121806780-121806802 AATTTTTTGTTGAAGTCTTTAGG + Intergenic
1031509925 7:122637359-122637381 AATTTCTTGTAGAGAACAGGAGG + Intronic
1031840460 7:126731602-126731624 TATTAATTGTAGAAGTCAGTAGG - Intronic
1033204685 7:139408515-139408537 AAAATCTTGTAGAAGTGACTTGG + Intronic
1033578625 7:142711306-142711328 CATTTCTTCTAGAACTAAGTTGG + Intergenic
1035902972 8:3478047-3478069 AATTTCATGTTGATGCCAGTGGG - Intronic
1036828822 8:12004035-12004057 AAATTCTTGAAAAAGTCATTGGG + Intergenic
1036834049 8:12043987-12044009 AAATTCTTGAAAAAGTCATTGGG + Intergenic
1037156168 8:15701877-15701899 AATTTCTTGAAGCAAACAGTAGG + Intronic
1038103166 8:24402661-24402683 AATATCTTTTAGAAGGCAATGGG - Intronic
1038554463 8:28497333-28497355 ACTTTCTTGTAGCAACCAGTAGG + Intronic
1040007803 8:42635573-42635595 ATTTTCTTTTAGAAGTCCATGGG + Intergenic
1040090071 8:43389149-43389171 AGTTTCTTGTAGGAGTCTTTAGG + Intergenic
1043153522 8:76748280-76748302 ATGTTCTGCTAGAAGTCAGTAGG - Intronic
1043467134 8:80521354-80521376 TATTTCTGGTAGAAATTAGTTGG + Exonic
1044029756 8:87221867-87221889 AATAACTTGTAGAAGACAGCAGG - Intronic
1044916845 8:97122350-97122372 AATGTCTTGTAGAAGACAATGGG + Intronic
1045101979 8:98853891-98853913 AATGTTTGGTAGAATTCAGTGGG - Intronic
1045788513 8:105954848-105954870 ACTCTCTTATAGAAGTCAATGGG + Intergenic
1046134239 8:110005706-110005728 AATTTTTTGTTGAAGTCTTTAGG + Intergenic
1046205986 8:110998338-110998360 AATTTCTTGTAAAATTCATATGG + Intergenic
1048071620 8:131027594-131027616 AATTTCATGTAGATATCAGACGG + Intronic
1051295040 9:15586671-15586693 AATTGCTAGTGGAAGTCAGGAGG + Intronic
1051689547 9:19695614-19695636 AAATTCTTGTACATGTCACTAGG + Intronic
1051862116 9:21638132-21638154 AATTTCTTGTCGAATTCTGTTGG - Intergenic
1052197818 9:25739364-25739386 CACTTCTTGTAGGAGACAGTTGG + Intergenic
1052621060 9:30910917-30910939 ATTTTATTGTAGAAGCCAGTAGG + Intergenic
1052891960 9:33709783-33709805 AATTTCTTCTAGAACTGAGCTGG + Intergenic
1052920830 9:33966894-33966916 AATTTTTTTTAAAAATCAGTGGG + Intronic
1053563515 9:39221986-39222008 AATTTTTTGTTGAAGTCTTTAGG + Intronic
1053829299 9:42059914-42059936 AATTTTTTGTTGAAGTCTTTAGG + Intronic
1054133632 9:61397080-61397102 AATTTTTTGTTGAAGTCTTTAGG - Intergenic
1054601260 9:67127533-67127555 AATTTTTTGTTGAAGTCTTTAGG - Intergenic
1055504009 9:76930014-76930036 AATTTCATAAAGTAGTCAGTGGG + Intergenic
1056491814 9:87115894-87115916 AGTTTCTTGTCTAAGTCAATGGG - Intergenic
1056717550 9:89045030-89045052 AATTTGTTGTAGGAGTCACGGGG + Intronic
1057853559 9:98584157-98584179 AATATCCTCTAGAAGTGAGTGGG - Intronic
1057973726 9:99581636-99581658 ACTTGCTTGTAGAAGACAGAAGG + Intergenic
1060144579 9:121240589-121240611 AAATTCTTGGAAGAGTCAGTTGG + Intronic
1060289600 9:122289118-122289140 AAATACATGTAGAATTCAGTAGG + Intronic
1186457600 X:9722255-9722277 AAGTTCTTGAAGAAGTGAGAAGG - Intergenic
1186536811 X:10358578-10358600 AATTTCTTCTAGAACACTGTTGG - Intergenic
1186883337 X:13888215-13888237 ACTTTCTTGCAGAAGCCATTTGG + Intronic
1187020137 X:15373096-15373118 ACTTTTTTGTTGAATTCAGTAGG - Intronic
1190825146 X:54010962-54010984 AATTTCATGTGGTAGTCAGTGGG - Intronic
1191654734 X:63584515-63584537 ACTTTCTTGTATAATTCATTTGG + Intergenic
1193092994 X:77514081-77514103 AATTTCTTTTAGCAGTCTTTTGG - Intronic
1193365925 X:80633122-80633144 AATATATTGTGGAATTCAGTTGG + Intergenic
1193848142 X:86500463-86500485 TATTTCTTGAAGGAGTGAGTAGG - Intronic
1194040131 X:88930637-88930659 AATTTCTTGTAGAGCTGATTTGG + Intergenic
1196226578 X:113175217-113175239 AATTTGTTATAAAACTCAGTTGG + Intergenic
1197118550 X:122862850-122862872 AAATTATTGTGGAAGCCAGTAGG - Intergenic
1197806918 X:130406252-130406274 AAATACTTGTAGAAGAAAGTTGG - Intronic
1198147516 X:133872311-133872333 AACTTCTTGTAGAAGAAAGCTGG + Intronic
1198174042 X:134137109-134137131 ACTTTATTGTTGAAGCCAGTTGG - Intergenic
1198561043 X:137850464-137850486 AAGTTCTTGAGGAAGTTAGTAGG - Intergenic
1199215131 X:145253844-145253866 AATTTCTTGCAGAAGGAGGTAGG + Intronic
1199304308 X:146249584-146249606 AATGTGTTGTTGAATTCAGTTGG - Intergenic
1201773073 Y:17637165-17637187 ACTTTTTTGGAGAACTCAGTGGG - Intergenic
1201828482 Y:18268821-18268843 ACTTTTTTGGAGAACTCAGTGGG + Intergenic
1202129261 Y:21595306-21595328 AATTTAGTGTGGAAGTCATTGGG - Intergenic