ID: 1150886761

View in Genome Browser
Species Human (GRCh38)
Location 17:69095677-69095699
Sequence CTGGTGATTGAATGTCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150886761_1150886764 -3 Left 1150886761 17:69095677-69095699 CCAGACAGACATTCAATCACCAG 0: 1
1: 0
2: 2
3: 15
4: 138
Right 1150886764 17:69095697-69095719 CAGTTGAGGATATCAGTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 128
1150886761_1150886768 21 Left 1150886761 17:69095677-69095699 CCAGACAGACATTCAATCACCAG 0: 1
1: 0
2: 2
3: 15
4: 138
Right 1150886768 17:69095721-69095743 GGCCTGAAGTGTAGGACTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 127
1150886761_1150886765 0 Left 1150886761 17:69095677-69095699 CCAGACAGACATTCAATCACCAG 0: 1
1: 0
2: 2
3: 15
4: 138
Right 1150886765 17:69095700-69095722 TTGAGGATATCAGTTAAAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 129
1150886761_1150886766 13 Left 1150886761 17:69095677-69095699 CCAGACAGACATTCAATCACCAG 0: 1
1: 0
2: 2
3: 15
4: 138
Right 1150886766 17:69095713-69095735 TTAAAGGAGGCCTGAAGTGTAGG 0: 1
1: 0
2: 0
3: 20
4: 275
1150886761_1150886770 29 Left 1150886761 17:69095677-69095699 CCAGACAGACATTCAATCACCAG 0: 1
1: 0
2: 2
3: 15
4: 138
Right 1150886770 17:69095729-69095751 GTGTAGGACTCAGGGCACTCTGG 0: 1
1: 0
2: 0
3: 13
4: 119
1150886761_1150886767 20 Left 1150886761 17:69095677-69095699 CCAGACAGACATTCAATCACCAG 0: 1
1: 0
2: 2
3: 15
4: 138
Right 1150886767 17:69095720-69095742 AGGCCTGAAGTGTAGGACTCAGG 0: 1
1: 0
2: 1
3: 9
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150886761 Original CRISPR CTGGTGATTGAATGTCTGTC TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
903169117 1:21541241-21541263 GTGCTGAGTGAATGTCAGTCAGG - Intronic
905650933 1:39656585-39656607 CTGATGATTCCATGTCTCTCAGG - Intergenic
906308940 1:44739232-44739254 CTGGTGAATCAGTGTCTTTCTGG + Intergenic
907038161 1:51235120-51235142 CTGTTGAATGAACGTCTATCAGG + Intergenic
909270750 1:73620605-73620627 CTGATGATTGTATTTCTGTGGGG - Intergenic
909450187 1:75789637-75789659 CTGGTGGTTTAAAGTCTTTCTGG + Intronic
911464640 1:98236233-98236255 CTGATGATTGTATTTCTGTGGGG - Intergenic
918982637 1:191583217-191583239 CTGATGATTGTATTTCTGTGGGG + Intergenic
919460750 1:197873805-197873827 GGGGTGATTGAGTGTCTATCTGG + Intergenic
921887989 1:220325595-220325617 ATGCTGATTGAACATCTGTCAGG - Intergenic
923177752 1:231484266-231484288 CTGGTACTTGAATCTGTGTCAGG - Intergenic
923541613 1:234892382-234892404 CTGCTGAATGAATGTCTGACTGG + Intergenic
924313130 1:242766931-242766953 CTGGTGTTTGGTTTTCTGTCAGG + Intergenic
1063818532 10:9807045-9807067 CTTGTCCTTGAATGTCTATCAGG - Intergenic
1066280130 10:33909072-33909094 CTGGTTAATGAATGTCAGTGAGG - Intergenic
1068062233 10:52082442-52082464 CTGGTGATTGCATGTTTCTGTGG + Intronic
1071180829 10:82981441-82981463 CTGGGGACTGACTGTCTCTCTGG + Intronic
1072119037 10:92389979-92390001 ATGGTGTTTGAATGACTGTCAGG + Intergenic
1074743652 10:116509095-116509117 CTGGTGTTTAAATATCTGTTGGG + Intergenic
1074774576 10:116757568-116757590 CTGGAGACAGAATGTCTTTCAGG + Intergenic
1075566591 10:123509461-123509483 CTGGTGTTTGACTGACTGTCTGG + Intergenic
1078640486 11:13090759-13090781 CAGGTTATTTAATGTCTGTCTGG - Intergenic
1079979901 11:27139690-27139712 CTGTTTATTGAATGTCTGCTGGG - Intergenic
1084773637 11:71360782-71360804 CTGGTGGTTCCATGGCTGTCTGG + Intergenic
1084807361 11:71588211-71588233 CTGGGGATTGACTATCTGACAGG + Intronic
1085224874 11:74910841-74910863 CTGGTGATTGAATGTATGTGTGG + Intronic
1086086923 11:82965036-82965058 CTGATGATTGTATTTCTGTGGGG + Intronic
1088888044 11:114022995-114023017 CTGGTAACTGAATGACTGTGGGG + Intergenic
1089949464 11:122511782-122511804 GTGGTGATTGATTGGCTGTGGGG - Intergenic
1090637500 11:128699923-128699945 AAGGTGATTGCATGTCTGTTAGG + Intronic
1091860319 12:3775677-3775699 CTGGTGACTGAATGAGTGTGAGG - Intergenic
1093803091 12:23397932-23397954 TACGTGATTGAATGTCTCTCTGG - Intergenic
1097749132 12:63332257-63332279 CTGGTGATTATATGTCTGAATGG - Intergenic
1098935280 12:76472287-76472309 CTGGTGATTGATTGGATGTGTGG - Intronic
1101121938 12:101591066-101591088 CTGGTGGTGGTATGTCTCTCTGG - Intronic
1104264126 12:127214918-127214940 CTGGTGATTATATTTCTGTAAGG + Intergenic
1108756560 13:53510154-53510176 CTGGCAATTGGAAGTCTGTCAGG + Intergenic
1109486343 13:63026537-63026559 CTGGTGATTGATTCTGTGTTAGG + Intergenic
1110655933 13:77998962-77998984 CTGCTGACTGAATGCATGTCAGG - Intergenic
1111407316 13:87825604-87825626 ATGGAGATTTCATGTCTGTCTGG - Intergenic
1114076233 14:19162629-19162651 CTGGGGACTGAATGTCAATCTGG + Intergenic
1114085929 14:19236940-19236962 CTGGGGACTGAATGTCAATCTGG - Intergenic
1115505001 14:34085438-34085460 CTGTTGATTATATGGCTGTCTGG - Intronic
1117194902 14:53330040-53330062 CTGGTGACTGAATGTTTATCTGG + Intergenic
1118485558 14:66211469-66211491 CTGGAGAATGACTGGCTGTCTGG - Intergenic
1119846661 14:77835551-77835573 CAGGTGACTGATTGTCTGACAGG - Intronic
1121001240 14:90453490-90453512 CTGCTGGTTGGATGTCTGCCAGG + Intergenic
1202897471 14_GL000194v1_random:18563-18585 CTGGGGACTGAATGTCAATCTGG - Intergenic
1126041535 15:44595743-44595765 CTGCTGATTAAAGGACTGTCTGG + Intronic
1130137909 15:81197150-81197172 CAGGTGAGTGAATGTCTGTCAGG + Intronic
1131256781 15:90868242-90868264 CTGCTCAATGAATGTCTGCCAGG + Intergenic
1131298089 15:91169845-91169867 CTGCTAAATGAATGTCTGACTGG - Intronic
1138542657 16:57697907-57697929 CTGGAGATGGAATGTCTCTGTGG - Exonic
1142314478 16:89334935-89334957 CTGCTGCTTGACTGTCTGCCTGG - Intronic
1145356555 17:22160942-22160964 CTGGTGATTGATTCTGTGTTAGG - Intergenic
1147194832 17:38759302-38759324 CTGGTGATTGTGTGGCTGACTGG + Intronic
1149682528 17:58516073-58516095 CAGCTGATTGAATATCTATCAGG - Intronic
1150333613 17:64314041-64314063 CAGGTGATGGAGAGTCTGTCAGG - Intergenic
1150886761 17:69095677-69095699 CTGGTGATTGAATGTCTGTCTGG - Intronic
1151390053 17:73780676-73780698 CTGCTGAATGAATGTATATCTGG + Intergenic
1151431643 17:74067598-74067620 CTGGGGCTTGAATGACTGTATGG - Intergenic
1153290276 18:3494801-3494823 CAGGTGACTGAATCTCTGTGAGG - Intergenic
1158830988 18:61278281-61278303 CTGAAGATGGAATGGCTGTCTGG + Intergenic
1159856376 18:73594524-73594546 ATGGTGATTGAATGAATGTTTGG + Intergenic
1160674042 19:379197-379219 CAGGTGATTGAAGGTCAGCCTGG + Intergenic
1163030858 19:14543239-14543261 CTGCTGAATGAATGTTTCTCAGG + Intronic
1165643460 19:37410562-37410584 CTGGTGATTTTATGTATGCCAGG - Intergenic
1168064995 19:53914319-53914341 CGGGTGGGTGGATGTCTGTCTGG - Intronic
1168209212 19:54877407-54877429 CTGATGATTGTATTTCTGTGGGG + Intronic
1168260477 19:55191266-55191288 CTGCTGAATGAATGAATGTCCGG + Intronic
926824635 2:16892002-16892024 GTGATGATTGAATGGCTTTCTGG + Intergenic
928456800 2:31429824-31429846 CTGCTGATTAAATCTCTGTGTGG - Intergenic
933155064 2:78964257-78964279 CTGGTGATTTAAAGTGGGTCAGG + Intergenic
933274003 2:80264862-80264884 CTGGTCATTGATTATCTGTTTGG - Intronic
936764709 2:115832768-115832790 ATTGTGATTGAATGTGGGTCGGG + Intronic
937338960 2:121078820-121078842 CTCCTCATTGAATGTGTGTCCGG + Intergenic
938490828 2:131760150-131760172 CTGGGGATTGAATGTCAATCTGG + Intronic
939179857 2:138791673-138791695 CTGATGATTGCATTTCTGTGGGG + Intergenic
941039429 2:160603817-160603839 CTTGTGAATAGATGTCTGTCAGG - Intergenic
942707088 2:178786447-178786469 TTGCTGATTGATTGTCTGCCTGG - Intronic
942963181 2:181857704-181857726 CTGGTGATTCAATGACTCACTGG + Intergenic
946792965 2:223320127-223320149 CTGGTGACTTAATGTGTGGCTGG - Intergenic
947325667 2:228973524-228973546 CTGCTGAATGAGTGTCTGCCAGG - Intronic
1170207870 20:13818833-13818855 ATTCTGTTTGAATGTCTGTCAGG + Exonic
1170710383 20:18785508-18785530 CTGGTGTTGGAATGTTAGTCAGG - Intergenic
1173069036 20:39743655-39743677 GTGGTAATTGTATGTGTGTCTGG + Intergenic
1173181159 20:40807315-40807337 CTGGAGAGTGAATGGCTGGCAGG + Intergenic
1176617156 21:9034552-9034574 CTGGGGACTGAATGTCAATCTGG - Intergenic
1176707986 21:10129109-10129131 CTGGGGACTGAATGTCAATCTGG + Intergenic
1177513312 21:22117807-22117829 CTGGTGATTTCATGTGTGTGTGG - Intergenic
1180292040 22:10856253-10856275 CTGGGGACTGAATGTCAATCTGG + Intergenic
1180494844 22:15885675-15885697 CTGGGGACTGAATGTCAATCTGG + Intergenic
1182141384 22:27962333-27962355 GTGGTAATTGGATGTCTTTCAGG + Intergenic
949484399 3:4523849-4523871 CTGGTGCTTGGATGTATGTATGG + Intronic
951520244 3:23604659-23604681 CAGGTGACTCAGTGTCTGTCAGG + Intergenic
959991407 3:112636229-112636251 CTGATACTTGAATGTCTGTTAGG - Intronic
963290678 3:143483966-143483988 CTGCTGAATGAATGACTATCTGG + Intronic
966396378 3:179507934-179507956 CTGGTGATTGATAGACTGTGAGG + Intergenic
967220812 3:187246483-187246505 TTGGTGATTAAATGGCTGTGCGG - Intronic
967532276 3:190562414-190562436 CTAGTGCTAGAATTTCTGTCTGG + Intronic
970425552 4:15942676-15942698 CTGGTAATTGAATGCATGTCTGG + Intergenic
971077844 4:23170716-23170738 CTGCTGTTTGAATGAGTGTCAGG - Intergenic
973243794 4:47988131-47988153 TTGGTGATTGATTGTTTGTGGGG + Intronic
975770263 4:77712887-77712909 CTGGTGGTTGTCTGTCAGTCAGG + Intergenic
977425422 4:96862376-96862398 CTTGAGATTCAGTGTCTGTCTGG - Intergenic
978163629 4:105580038-105580060 CTGATGATTGTATTTCTGTGAGG + Intronic
981502730 4:145469853-145469875 CAGGGGTTTGAATGTGTGTCAGG - Intergenic
984555642 4:181211228-181211250 CTGGTGATTAATTGGCTGTGTGG + Intergenic
987433754 5:17867627-17867649 CTGTTTATTGATTTTCTGTCTGG - Intergenic
989657133 5:43756845-43756867 CTGATGATTGTATTTCTGTGTGG + Intergenic
990567332 5:57042688-57042710 CTGGTGATTTACTGGCTGTTAGG - Intergenic
993463632 5:88217533-88217555 CTGGTTACTGAATGTGTGTGTGG + Intronic
995960297 5:117830616-117830638 CTGGTGTTTGTATTTCTGTGTGG + Intergenic
1003902362 6:10666677-10666699 CTGATGATTGTATTTCTGTGGGG + Intergenic
1007354382 6:41301559-41301581 CTGGATATTGAATCTTTGTCAGG - Intergenic
1008233989 6:49021507-49021529 CTGGTTATTATATGTTTGTCAGG + Intergenic
1012402138 6:98849376-98849398 CTGGTGCCTGAATGGCTGTAGGG + Intergenic
1013644805 6:112126148-112126170 CTTGAGATTGAATGTTTGTTGGG + Intronic
1014656971 6:124119102-124119124 ATGGTAATAGAATGTCTTTCAGG - Intronic
1015198738 6:130554178-130554200 CTGGTGACTGAATGGATGTCAGG + Intergenic
1017108166 6:150907566-150907588 CTCGTGATTGCATGGCTGACCGG + Intronic
1018116821 6:160594472-160594494 GTGGTGATTGACTGTCAGTGGGG + Intronic
1018542615 6:164898807-164898829 GTGATGATTTAATGTCTGTTTGG + Intergenic
1021761444 7:23905999-23906021 CTGGTGATTGACAGCATGTCAGG + Intergenic
1023339982 7:39209838-39209860 ATGGTGAGTGAATGTCTGACAGG + Intronic
1024097503 7:45994952-45994974 ATTATGATTGTATGTCTGTCTGG + Intergenic
1030696607 7:112591843-112591865 CTGGTGGTTGTATTTCTGTGGGG - Intergenic
1033004959 7:137551622-137551644 CTAGTGATTAAGTGTCTGTGGGG - Intronic
1033262841 7:139858533-139858555 GTAGCCATTGAATGTCTGTCTGG + Intronic
1034443735 7:151101242-151101264 CTGGTGGGGGAATGGCTGTCAGG + Intronic
1040375221 8:46818328-46818350 CTAGTGATTAAATCTCTTTCTGG + Intergenic
1041616690 8:59915553-59915575 CAGGTGACTGGATGTTTGTCAGG - Intergenic
1041726027 8:61018057-61018079 CTGGTTATTGACTGTGAGTCAGG + Intergenic
1042722453 8:71841271-71841293 CTGAGGAGTGTATGTCTGTCAGG + Intronic
1045673062 8:104578224-104578246 CTGATGATTGTATTTCTGTGGGG - Intronic
1048397012 8:134023453-134023475 CTGGTCTATGAATGTCTTTCAGG - Intergenic
1052447041 9:28576203-28576225 CTTGTGATTGCATGGCTGACCGG + Intronic
1053760799 9:41349007-41349029 CTGGGGACTGAATGTCAATCTGG - Intergenic
1057472888 9:95373546-95373568 ATTGTGAATGAATGTCAGTCGGG - Intergenic
1058585459 9:106502024-106502046 CTTGTGATTGCATGGCTGACTGG - Intergenic
1058913546 9:109543170-109543192 CTGGTGATTGCATGGCTGACTGG + Intergenic
1058986176 9:110210089-110210111 CTGCTGATTGAATGCCTTTTAGG + Intergenic
1059154618 9:111978790-111978812 GTGGTGATTGAATCTCTCTCAGG - Intergenic
1060140459 9:121205194-121205216 CTGGTGATGGTGTGTCTGTGGGG - Intronic
1202792730 9_KI270719v1_random:97989-98011 CTGGGGACTGAATGTCAATCTGG + Intergenic
1189196263 X:39156064-39156086 AGGGTGAATGAATGTCAGTCAGG - Intergenic
1192195024 X:69022277-69022299 CTGGTGGCTGAATGGCTGTTGGG + Intergenic
1192983355 X:76370348-76370370 TTGGTGTTTGAGTGTCTGTCGGG - Intergenic
1193354286 X:80499268-80499290 CTGATGATTGTATGTCTTTGGGG + Intergenic
1193970269 X:88042135-88042157 CTGTTGGGTAAATGTCTGTCAGG - Intergenic
1195299755 X:103516409-103516431 CTCGTGATTGCATGGCTGACTGG - Intronic
1198157186 X:133972780-133972802 CTGGTGATGGTATCTCTGTCTGG - Intronic
1199789374 X:151137729-151137751 CTGGTGATTGGCTGTCTGTGTGG - Intergenic
1199967700 X:152833620-152833642 CTGGCCATGGAATGTCTTTCAGG + Intronic
1201150546 Y:11093385-11093407 CTGGGGATTGAATGTCAATCTGG - Intergenic