ID: 1150887004

View in Genome Browser
Species Human (GRCh38)
Location 17:69098783-69098805
Sequence GATGGTTATTTCCAGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 0, 3: 51, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150886997_1150887004 26 Left 1150886997 17:69098734-69098756 CCACTTATATAAGGTTTCTAAAC 0: 1
1: 1
2: 27
3: 177
4: 898
Right 1150887004 17:69098783-69098805 GATGGTTATTTCCAGGGGATGGG 0: 1
1: 0
2: 0
3: 51
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150887004 Original CRISPR GATGGTTATTTCCAGGGGAT GGG Intronic
900925414 1:5703172-5703194 GATGGTGGTTGCCAGGGGCTGGG - Intergenic
901150460 1:7097823-7097845 GATGGTGGTTTCCAAGGGCTGGG + Intronic
901308918 1:8253945-8253967 GATGGTGGCTGCCAGGGGATAGG - Intergenic
902807245 1:18868783-18868805 GGTGGTTATGGCCAGGGGCTTGG + Intronic
905812568 1:40923361-40923383 GATGGTGGTTCCCAGGGGATGGG - Intergenic
905859125 1:41335524-41335546 AATGGTGGTTTCCAGGGGCTAGG - Intergenic
906558950 1:46739760-46739782 GATGATGTTTACCAGGGGATGGG - Intergenic
906694741 1:47816342-47816364 CATGGTTATTCCCAGGGCAGAGG - Intronic
907084241 1:51654890-51654912 AATGGTGGTTTCCAGGGGTTGGG + Intronic
907446182 1:54509345-54509367 GATGGTTATGGCTAGGGAATGGG - Intergenic
907713087 1:56902658-56902680 CATGGTTGTTGCCAGGGGCTGGG - Intronic
907797387 1:57731295-57731317 GATGGTGGTTTCCAGGGGACAGG + Intronic
908379254 1:63579240-63579262 AATAGTGGTTTCCAGGGGATAGG - Intronic
908402337 1:63783124-63783146 GAAGCTGATCTCCAGGGGATGGG + Intronic
909997815 1:82302584-82302606 TATGGTTGTTTCCAGGGAATTGG + Intergenic
911166140 1:94726093-94726115 GATGAATATTTCTAGGGGAAAGG - Intergenic
911361459 1:96882274-96882296 AATGGTGATTGCCAGGGGCTGGG + Intergenic
911529942 1:99032332-99032354 AATGGTGATTACCAGGGGCTAGG - Intergenic
911674277 1:100641550-100641572 AATGGTAATTGCCAGGGGTTTGG + Intergenic
913399422 1:118412772-118412794 AATGGTGGTTGCCAGGGGATGGG - Intergenic
913645126 1:120848103-120848125 GATGGTTATTGCCAAGGAAGAGG + Intergenic
914676860 1:149912711-149912733 GATGGGAGTTTCCAGGGGACAGG - Intronic
914911153 1:151788104-151788126 CTTCGTTATTTGCAGGGGATTGG - Intronic
915022419 1:152793644-152793666 AATGGTGATTGCCAGGGGCTGGG + Intronic
915027566 1:152845354-152845376 CATGGTTATTTTTAGGTGATAGG - Intergenic
916733517 1:167587144-167587166 GAGGGACATTTCCAGGGCATGGG - Intergenic
917114780 1:171591852-171591874 TATGGTTTATTGCAGGGGATTGG + Exonic
918278923 1:182983718-182983740 AATGGTGGTTTTCAGGGGATAGG - Intergenic
918733544 1:188029618-188029640 AATGATGATTGCCAGGGGATGGG + Intergenic
918843070 1:189569619-189569641 GCTGGTTGTTACCAGGGGGTTGG + Intergenic
919377064 1:196808353-196808375 GATTGTTATTTCCAGTGAATAGG + Intergenic
919386767 1:196933244-196933266 GATTCTTATTTCCAGTGAATAGG + Intronic
921411649 1:214842434-214842456 GATGGTGGTTGCCAGGGGCTGGG - Intergenic
921761410 1:218919409-218919431 GATGGGAATTTCCAGGAGAAAGG - Intergenic
921921788 1:220677840-220677862 GATGGTGGTTGCCAGGGGGTGGG + Intergenic
923090128 1:230734364-230734386 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
923409916 1:233697253-233697275 GATGGTAATTACCAAGGGCTGGG + Intergenic
924055903 1:240123838-240123860 AATGGTTGTTGCCAGGGGCTTGG - Intronic
1064732785 10:18349644-18349666 AATGGTGGTTTCCAGGGGCTGGG + Intronic
1064879678 10:20036625-20036647 GTTGTTTACTTCCAGTGGATTGG + Intronic
1065301063 10:24321739-24321761 AATGGTGATTGCCAGGGGCTGGG + Intronic
1068082747 10:52340029-52340051 AATGGTGATTGCCAGGGGCTGGG + Intergenic
1069893283 10:71665230-71665252 GACGGTTCTTGCCAGCGGATAGG - Intronic
1070205489 10:74255286-74255308 GTTGGTTGTTTCCAGGTGGTTGG + Intronic
1070261810 10:74863768-74863790 GATGCTTATCTGCAGGGCATAGG - Intronic
1070352644 10:75608306-75608328 AATGGTTGTTACCAGGGGATGGG + Intronic
1070494796 10:77011601-77011623 TATCGTGATTTCCAGTGGATTGG - Intronic
1071471121 10:85984622-85984644 GATGTTTCTTTCCAGGTGCTGGG - Intronic
1071693914 10:87852445-87852467 GGGGGTTATTTATAGGGGATAGG + Intergenic
1072899902 10:99397985-99398007 GATGGTTGTTTTTAGGTGATAGG - Intronic
1073182194 10:101590794-101590816 AATGGTGGTTGCCAGGGGATGGG - Intronic
1073896229 10:108162590-108162612 AATGGTTCTTCCCAGGGGCTAGG + Intergenic
1074311328 10:112325625-112325647 GGTGGTGATTACCAGGGGTTGGG - Intergenic
1078657692 11:13257344-13257366 AATGGTGATTTCCAGGGGCTGGG + Intergenic
1078657897 11:13259468-13259490 AATGGTGATTGCCAGGGGCTGGG + Intergenic
1078823621 11:14906315-14906337 GATGGGTTTGTCCAGGGGTTTGG + Intronic
1081007487 11:37764108-37764130 AATGGTGATTTCCAGGGACTAGG - Intergenic
1081130986 11:39379973-39379995 AATGGTGATTTCCAGGGACTGGG - Intergenic
1081956036 11:47094290-47094312 GATGGTGGTTTCCAGGGATTGGG + Intronic
1082617768 11:55382236-55382258 AATGGTGGTTTCCAGGGGCTGGG - Intergenic
1083142671 11:60734643-60734665 CATGGTGATTGCCAGGGGCTGGG + Intronic
1083190261 11:61046429-61046451 GGTGGTTATCTCCAGGTGGTAGG - Intergenic
1083369714 11:62168567-62168589 AATGGTGATTGCCAGGGGACGGG - Intergenic
1083459885 11:62804117-62804139 GAGGGTTCTTTCCTGTGGATAGG - Intronic
1084874322 11:72119638-72119660 GATGGTGGTTTCCAGGGGCTGGG + Intronic
1085752427 11:79173258-79173280 GATAGTTATTTCCATGGGAAGGG + Intronic
1085907028 11:80775781-80775803 GATGGTGGTTACCAAGGGATGGG + Intergenic
1088996581 11:115005108-115005130 GATGGTGGTTGCCAGGGGCTGGG + Intergenic
1089350575 11:117819572-117819594 GTTGGTTAATTCCAGGGCCTGGG - Intronic
1092814211 12:12298865-12298887 GTTGGTGGTTTCCAGGGGTTGGG - Intergenic
1093763534 12:22937254-22937276 AATGGTGATTTCCAAGGCATTGG - Intergenic
1094404616 12:30103220-30103242 AATGGTGGTTACCAGGGGATGGG - Intergenic
1095183194 12:39170310-39170332 AATGGTGATTACCAGGGAATCGG + Intergenic
1095363725 12:41375913-41375935 AATGGATGTTGCCAGGGGATGGG - Intronic
1095422112 12:42035230-42035252 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
1095483491 12:42659510-42659532 AAAGGTTATTTCCAGGGGTTGGG - Intergenic
1097894067 12:64807004-64807026 AATGGTGGTTTCCAGGGGCTGGG + Intronic
1098556125 12:71820914-71820936 AATGGTGATTTCTAGGGGCTAGG - Intergenic
1098869129 12:75797147-75797169 GATTGGTATTTCCAGGGGGTAGG + Intergenic
1099372099 12:81847123-81847145 GATGGTGGTTACCTGGGGATGGG + Intergenic
1100653702 12:96618052-96618074 AATGAGTATTTCCAGGGGAGGGG + Intronic
1101505929 12:105346137-105346159 GGGGGTTGTTTCCAGGTGATAGG - Intronic
1101530333 12:105567755-105567777 AATAGTTCTTTCCTGGGGATGGG + Intergenic
1102832361 12:116015397-116015419 TAGTGTTATTGCCAGGGGATAGG - Intronic
1103057842 12:117835667-117835689 GATGGTCACTACCAGGGGCTAGG + Intronic
1103340096 12:120216537-120216559 GATGGTTCTTCTCAGGGGAATGG + Intronic
1104513489 12:129402744-129402766 GATGGTGATGTCAAGAGGATGGG + Intronic
1104671567 12:130684217-130684239 GATGGGGACTTCCAGGTGATAGG - Intronic
1105388240 13:19952207-19952229 AATGGTGATTACCAGGGGCTGGG + Intergenic
1106203208 13:27562180-27562202 GATGGTTATTTACAGAGCGTAGG - Intronic
1106338203 13:28803818-28803840 GATGGTGGTTGCCAGGGGCTGGG - Intergenic
1106495990 13:30275539-30275561 AGTGGTTATTACCAGGGGCTAGG + Intronic
1106812535 13:33374261-33374283 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
1106815110 13:33399305-33399327 GATGGTGGTTACCAGGGGATGGG + Intergenic
1106815207 13:33400143-33400165 GATGGTGGTTACCAGGGGATGGG - Intergenic
1106945685 13:34824968-34824990 AATGGTGGTTTCCAGGGGCTGGG - Intergenic
1108368321 13:49740826-49740848 GATGGTGGTTACCAGGGGCTGGG - Intronic
1108744680 13:53380004-53380026 AATGGTGATTGCCAGGGGATGGG - Intergenic
1109648115 13:65287710-65287732 AATGGTGGTTACCAGGGGATGGG - Intergenic
1109900525 13:68763305-68763327 AATGGTGATTACTAGGGGATAGG - Intergenic
1110088961 13:71420670-71420692 AATGGTGGTTACCAGGGGATGGG - Intergenic
1110702157 13:78561660-78561682 GATAGTTATTGCCAAGGGTTAGG + Intergenic
1111294364 13:86259714-86259736 AATGGTGATTGCCAGGGGCTAGG + Intergenic
1111369723 13:87301467-87301489 GATAGTTGTTTCCAGGGGTGGGG + Intergenic
1111374471 13:87360402-87360424 AATGGTGATTGCCAGGGGCTGGG + Intergenic
1112943834 13:104899691-104899713 AATGGTGATTACCAGAGGATGGG + Intergenic
1115899804 14:38132745-38132767 AATGGTGATTGCCAGGGGCTGGG + Intergenic
1116742507 14:48775147-48775169 GTTGGTTATCTGTAGGGGATGGG + Intergenic
1116836003 14:49769277-49769299 GTTGTTTATAACCAGGGGATCGG - Intronic
1118012020 14:61619176-61619198 AATGGTGGTTGCCAGGGGATGGG + Intronic
1118091882 14:62490294-62490316 AATGGTGGTTTCCAGAGGATTGG - Intergenic
1118844286 14:69535025-69535047 AATGGTGATTGCCAGGGGCTGGG - Intergenic
1119797917 14:77416042-77416064 AATGGTAGTTTCCAGGGGCTGGG - Intronic
1119881388 14:78102724-78102746 AATGGTGATTTCCAGGAGCTAGG + Intergenic
1119895832 14:78219204-78219226 GGTGACTATTTCCAGGGGATGGG + Intergenic
1121300698 14:92868363-92868385 AATGGTGATTTCCAGGGGCTGGG + Intergenic
1121764231 14:96472008-96472030 GATGGTGGTTGCCAGGGGCTGGG - Intronic
1123067118 14:105624312-105624334 GATGGTTCTTTCCACGGGTCAGG - Intergenic
1123076100 14:105668081-105668103 GATGGTTCTTTCCACGGGTCAGG - Intergenic
1123090801 14:105741309-105741331 GATGGTTCTTTCCACGGGTCAGG - Intergenic
1123096436 14:105769073-105769095 GATGGTTCTTTCCACGGGTCAGG - Intergenic
1123907812 15:24937782-24937804 AATGGTGGTTGCCAGGGGATGGG - Intronic
1124585520 15:31002377-31002399 TTTGGTTTCTTCCAGGGGATAGG + Exonic
1125599608 15:40907967-40907989 GGTTGTCATTTCAAGGGGATTGG + Intergenic
1127197460 15:56604831-56604853 AATTGTGATTGCCAGGGGATAGG + Intergenic
1127421363 15:58809241-58809263 AATGGTTGTTTCCAGGGGACTGG - Intronic
1128355617 15:66924379-66924401 GGTGGTTGTTGCCAGAGGATGGG - Intergenic
1129902452 15:79161323-79161345 GATGGTGCTTTGGAGGGGATTGG + Intergenic
1131780273 15:95848754-95848776 AATGGTGATTACCAGGGGCTGGG - Intergenic
1132043790 15:98547789-98547811 GAAGGATATCACCAGGGGATGGG - Intergenic
1133095141 16:3439445-3439467 GGTGGTTCTTTCCACGGCATTGG - Intronic
1133268364 16:4598416-4598438 ATTGGTGATTTCCAGGGGCTGGG + Intronic
1134318277 16:13139699-13139721 GATGGTCAATTCCAGTGGTTTGG - Intronic
1134563729 16:15232822-15232844 GATGGTGATTACCAGAGGCTGGG + Intergenic
1135124381 16:19796024-19796046 AATGGTGATTGCCAGGGGCTAGG - Intronic
1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG + Exonic
1135213389 16:20543165-20543187 GATGGGTATTTCCAGTTTATGGG - Exonic
1135264974 16:21016977-21016999 AATGGTTATTTCCAGGGTAGGGG + Intronic
1137750174 16:50855545-50855567 AATGGTTGTTGCCAGGGGCTGGG - Intergenic
1138692135 16:58777999-58778021 GATGGTGATTGCCAGGGGCTGGG - Intergenic
1139766688 16:69236475-69236497 AATGGTGGTTGCCAGGGGATAGG + Intronic
1141326515 16:83065021-83065043 GATGGTGATTACCTGGGGCTGGG - Intronic
1144347582 17:14363613-14363635 CATGATTATTTCCAGGTGGTAGG - Intergenic
1144601121 17:16615026-16615048 GATGGTGGTTTCCAGGGTTTAGG + Intergenic
1146180546 17:30695451-30695473 ATTGGTGATTGCCAGGGGATGGG - Intergenic
1146652936 17:34617926-34617948 GGTGGTTATCTCTAGGGGGTGGG - Intronic
1146658320 17:34648404-34648426 GATGGTAACTTCCAGGGCATTGG + Intergenic
1148058713 17:44819210-44819232 AATGGTGATTGCCAGGGGCTGGG - Intronic
1149024858 17:52015951-52015973 GATGGTAGTTTCCAGGTGAGTGG + Intronic
1149369610 17:55979721-55979743 GATGGTGGTTTCCAGGGGCTGGG - Intergenic
1150346865 17:64411302-64411324 GATGGGTATATGCAGTGGATAGG + Intronic
1150509785 17:65738577-65738599 GGTGGTTATTTCTGGGTGATAGG + Intronic
1150862352 17:68814005-68814027 AATGGTTGTTTCCAGAGGCTGGG - Intergenic
1150887004 17:69098783-69098805 GATGGTTATTTCCAGGGGATGGG + Intronic
1151778044 17:76221989-76222011 ACTGGTGATTGCCAGGGGATGGG + Intronic
1151974631 17:77477318-77477340 ATTGGTGATTTCCAGGGGCTGGG - Intronic
1152167529 17:78720071-78720093 GATGGATGTTGCCAGGGGCTGGG + Intronic
1153091649 18:1353111-1353133 GATGGTTATTGCCAAAGGTTGGG + Intergenic
1153111361 18:1592807-1592829 GATGGTTGCTGCCAGGGGCTCGG + Intergenic
1153341022 18:3975003-3975025 AATGGTGATTGCCAGGGGCTGGG + Intronic
1153604908 18:6823229-6823251 AATGGCTACTTCCAGAGGATAGG - Intronic
1153713847 18:7825681-7825703 GGTGCTTACTTCTAGGGGATGGG - Intronic
1154301459 18:13196311-13196333 AATGGTGATTGCCAGGGGCTGGG - Intergenic
1155369322 18:25081115-25081137 GATGAACATTTCCAGGGGGTGGG + Intronic
1156019805 18:32586934-32586956 AATGGTGATTACCAGGGAATGGG - Intergenic
1156385581 18:36601904-36601926 GGTGGTTATTTCCAGGATCTAGG - Intronic
1156850440 18:41719607-41719629 AATGGTGGTTTCCAGGGGTTGGG + Intergenic
1157295214 18:46437467-46437489 GATGGTTCTCTAAAGGGGATAGG - Intronic
1157837648 18:50921789-50921811 CATGCTTTTTTCCTGGGGATAGG - Intronic
1158090068 18:53700670-53700692 AATGGTGATTTCCAGGGGCTGGG - Intergenic
1158339660 18:56451699-56451721 GATGGTTATATCAGGGGAATTGG + Intergenic
1158738973 18:60117348-60117370 GATGTTTATTTCCAAGTGAAGGG + Intergenic
1158789068 18:60753187-60753209 AATGGTGCTTACCAGGGGATAGG + Intergenic
1158819098 18:61137609-61137631 AATGGTAATTGCCAGGGGCTGGG - Intergenic
1159683458 18:71385446-71385468 AATGGTAGTTTCCAGGGGCTGGG + Intergenic
1160574501 18:79844375-79844397 AATGGTGGTTGCCAGGGGATTGG + Intergenic
1161171677 19:2815354-2815376 GTTGGTGACTTCCAGGGGAGTGG - Exonic
1161346240 19:3770152-3770174 ATTTGTTATTTCCAGGGGACTGG + Exonic
1161466651 19:4434516-4434538 GTTGGTGATTTCCAAGGGATTGG - Intronic
1162181847 19:8874923-8874945 GATGGTGGTTGCCAGGGGCTGGG + Intronic
1162695842 19:12474205-12474227 AATGGTAATTTGCAGGGGAAGGG - Intronic
1162881062 19:13659842-13659864 GATGGTGGTTGCCAGGGGCTGGG + Intergenic
1163684735 19:18704951-18704973 GATGGTGGTTGCCAGGGGCTGGG - Intronic
1164762526 19:30738596-30738618 GATGCCTATTTGTAGGGGATGGG + Intergenic
1165202239 19:34154531-34154553 GATGGTGGTTTCCAGGGGCTGGG + Intergenic
1168397258 19:56059024-56059046 AATGGTGATTTCCAAAGGATTGG + Intronic
1168464729 19:56593111-56593133 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
1168591169 19:57635409-57635431 AATGGTGGTTGCCAGGGGATGGG - Intronic
925193064 2:1900834-1900856 GATGCTTGTTTCTAGGGGGTCGG + Intronic
927258843 2:21065637-21065659 GATGGTGGTTGCCAGGGGCTTGG + Intergenic
927795411 2:26043966-26043988 AATGGTGATTACCAGGGGCTGGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927912793 2:26913279-26913301 GATGGTGATTGCCAGGGACTAGG - Intronic
930138806 2:47930910-47930932 AATGGTGGTTTCCAGGGGATAGG + Intergenic
930596607 2:53397425-53397447 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
930838615 2:55822051-55822073 AATGGTGGTTGCCAGGGGATCGG + Intergenic
931153853 2:59605528-59605550 ATTGGTCATTTCCAGGGGCTTGG - Intergenic
931595466 2:63938002-63938024 AATGGTGGTTGCCAGGGGATTGG + Intronic
932263920 2:70350353-70350375 AATGGTGATTACCAGGGGCTGGG - Intergenic
932375307 2:71230119-71230141 AATGGTGATTTCCAGGGGCTGGG - Intergenic
932711675 2:74069926-74069948 AATGGTTACTTCTAGGGGATGGG - Intronic
932833867 2:75016538-75016560 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
933155937 2:78974548-78974570 AATGGTGGTTGCCAGGGGATGGG - Intergenic
933319976 2:80761224-80761246 GATGGTTAGTTCCATAGGTTGGG + Intergenic
934905077 2:98193082-98193104 GATGGTTATGAGCAGTGGATAGG + Intronic
936889895 2:117356971-117356993 AATGGTGGTTGCCAGGGGATGGG - Intergenic
937141213 2:119602659-119602681 GATGGTTATTTGCAGGATTTGGG - Intronic
937421462 2:121759768-121759790 GATGAGTATTTTCAGGGGGTGGG + Intronic
937574372 2:123401385-123401407 AATAGTGAGTTCCAGGGGATGGG - Intergenic
937688553 2:124725729-124725751 AATGGTAGTTTCCAGGGGCTGGG - Intronic
938245468 2:129773670-129773692 AATGGTGATTACCAGGGGCTGGG - Intergenic
938394423 2:130932072-130932094 GATGAGTATTTCCAGGGTCTGGG - Intronic
939237789 2:139519833-139519855 GATGGAAATTTCTAGGGGAGGGG + Intergenic
939481881 2:142759063-142759085 GATGATGATTGCCAGAGGATGGG + Intergenic
939746453 2:145976364-145976386 AATGGTTGTTAGCAGGGGATAGG + Intergenic
940920621 2:159302211-159302233 AATAGTTATTTCCAGGGACTTGG + Intergenic
942266560 2:174233202-174233224 AATGGTGGTTTCCAGGGGCTGGG + Intronic
942758733 2:179373137-179373159 GATGGTTCTTTCCATGGCCTAGG + Intergenic
943715472 2:191147482-191147504 AATGGTGATTGCCAGGGGTTGGG + Intronic
943830745 2:192458635-192458657 AATGGTGATTTCCAGGAGCTGGG - Intergenic
944042579 2:195373010-195373032 GATGGTTATTTGATGGGGGTGGG + Intergenic
944117377 2:196203880-196203902 AATGGTGGTTTCCAGGGGCTAGG - Intronic
944143479 2:196481910-196481932 GGTAGTTCTTTCCATGGGATGGG - Intronic
944911366 2:204313551-204313573 GTTGGTCATTTCCAAGGTATTGG + Intergenic
945238773 2:207657486-207657508 GATAGTTATTTCTTGGTGATGGG + Intergenic
945519046 2:210800312-210800334 CATGCTTATTTCCAGGTGGTTGG + Intergenic
945598872 2:211833138-211833160 GATTGTGATTACAAGGGGATGGG - Intronic
945684697 2:212954923-212954945 AATGGTGATTGCCAGGGGCTGGG + Intergenic
946343611 2:219089554-219089576 AGTAGTGATTTCCAGGGGATAGG + Intronic
947148944 2:227094521-227094543 GATGGTGGTTCCCAGGGGCTGGG + Intronic
947505358 2:230704296-230704318 CATGGTTGCTGCCAGGGGATGGG + Intergenic
947705332 2:232270293-232270315 CATGGTTATTTCTGGGTGATGGG - Intronic
947763251 2:232619252-232619274 ATTGGTTGTTGCCAGGGGATGGG + Intronic
948194921 2:236088065-236088087 GATGGTTATTTCCAGAAAAGTGG + Intronic
948224152 2:236295761-236295783 AATGGTGATTGCCAGGGGCTGGG - Intergenic
948679182 2:239620808-239620830 GATGGTTACCTCCAGGGGAAGGG - Intergenic
1169712795 20:8583173-8583195 GATGGTGGTTGCCAGGGGCTAGG + Intronic
1170289289 20:14749896-14749918 AATGGTAATTACCAGGGGCTAGG + Intronic
1170322239 20:15112805-15112827 AATGGTAGTATCCAGGGGATAGG - Intronic
1170942452 20:20859702-20859724 GATGGTAATGCCTAGGGGATTGG + Intergenic
1172041098 20:32046612-32046634 GATGGTTATAAACAGGGGAGTGG - Intergenic
1174332977 20:49835530-49835552 ATTGGTGGTTTCCAGGGGATGGG - Intronic
1174989216 20:55490676-55490698 AATGGTGGTTTCCAGGGCATGGG - Intergenic
1175571852 20:60029153-60029175 AATGGTAGTTTCCAGGAGATGGG + Intronic
1175713277 20:61238164-61238186 CATGGTGGTTTCCAGGGGCTTGG + Intergenic
1177233839 21:18360110-18360132 AATGGTGATTGCCAGGGGCTGGG - Intronic
1177314045 21:19433483-19433505 GATGGTTAGTGCCAGGAGAAAGG - Intergenic
1178957211 21:37033724-37033746 GATGGTGATTACCAGAGGCTGGG - Intergenic
1179429988 21:41315256-41315278 AATGGTGGTTTCCAGGGGCTGGG + Intronic
1181774768 22:25151228-25151250 AAGGATCATTTCCAGGGGATGGG - Intronic
1182656470 22:31894472-31894494 GATGTTTATTAACAGGGGACTGG - Intronic
1182889593 22:33806108-33806130 ATTGGTTATTACCAGGGGCTGGG - Intronic
1183193012 22:36333930-36333952 GTTGGTTTATTTCAGGGGATGGG + Intronic
1184054564 22:42035826-42035848 GATGGTGGTTGCCAGGGGCTGGG - Intronic
1184346870 22:43918923-43918945 GATGGTGGTTTCCAGGGGCTGGG + Intergenic
949178357 3:1094967-1094989 GATTGTTATTTACAGGTGATGGG - Intronic
950666785 3:14501183-14501205 GATAGCAATTGCCAGGGGATGGG + Intronic
950905367 3:16532934-16532956 AATGGTTGTTTCCAGGGGCTAGG - Intergenic
951900107 3:27648546-27648568 CATGGTTATTTCCAGGCAATAGG - Intergenic
952095171 3:29942640-29942662 TGTGGCTATTTCCAGGTGATGGG + Intronic
952457954 3:33491980-33492002 GATGGTGGTTGCCAGGGGCTGGG - Intergenic
953114733 3:39980860-39980882 GATGGTAGTTGCCAGGGGCTGGG + Intronic
953678274 3:45020256-45020278 GATGGTGGTTTCCAGGGGCTTGG - Intronic
955141669 3:56275910-56275932 GATAGTTCTTTGCTGGGGATGGG - Intronic
955159940 3:56455026-56455048 AATGGTGGTTTCCAGGGGCTGGG + Intronic
955207989 3:56914819-56914841 AATGGTGGTTGCCAGGGGATGGG + Intronic
955559642 3:60174830-60174852 GTTGGTCATTTCTAGGGGCTGGG - Intronic
955642970 3:61106469-61106491 GATGGTTGTTGCCAAGGGCTGGG - Intronic
956112912 3:65888832-65888854 AATGGTTATTCCAAGGGGTTTGG + Intronic
956852221 3:73239806-73239828 GATGGTTGTTACCAGAGGCTGGG - Intergenic
959109638 3:102106529-102106551 AATGGTGATTACCAGGGGCTGGG - Intronic
959755288 3:109890035-109890057 AATGGTGGGTTCCAGGGGATAGG - Intergenic
959928962 3:111957767-111957789 GATGGTTATTTCCTGTGGCTAGG + Intronic
961576300 3:127839446-127839468 AATGGTGGTTGCCAGGGGATGGG + Intergenic
962764410 3:138548482-138548504 CCTGGTTATATCCAGGAGATTGG + Intronic
964078048 3:152715857-152715879 GATGGCTAATTCCAGGGCCTGGG - Intergenic
965329484 3:167352787-167352809 GTGGGTTTTATCCAGGGGATGGG + Intronic
965851476 3:173031052-173031074 AATGGTGATTGCCAGGGGACAGG + Intronic
966503334 3:180671260-180671282 GGTGGTAACTTCCAGGTGATTGG - Intronic
967358419 3:188600719-188600741 AATGGTGATTGCCATGGGATGGG - Intronic
969128547 4:4973343-4973365 AATGGTGAGTACCAGGGGATAGG - Intergenic
969946000 4:10783693-10783715 GATGGATGTTTCCATGGGAGTGG + Intergenic
971248636 4:24952845-24952867 AATGGTGGTTGCCAGGGGATGGG - Intronic
974544746 4:63286959-63286981 AATGGTTGTTTCCAGGGACTGGG - Intergenic
974930361 4:68354165-68354187 GATGGTTGTTGCCAGGGACTAGG + Intergenic
974966542 4:68768121-68768143 AATAGTGATTTCCAGGGGTTTGG - Intergenic
976329066 4:83807425-83807447 AATGGTGGTTTCCAGGGGCTGGG - Intergenic
976784266 4:88800124-88800146 AATGGTGGTTGCCAGGGGATAGG + Intronic
976793702 4:88909415-88909437 ATTGGTTATTGCCAGGGGTTGGG + Intronic
977660887 4:99584678-99584700 GATGGTTATTTCCAGCTGGCTGG - Intronic
978162372 4:105564467-105564489 AATGGTGGTTTCCAGGGGCTGGG + Intronic
979794931 4:124834528-124834550 CAAGTTCATTTCCAGGGGATGGG + Intergenic
980760070 4:137221374-137221396 AATGGGGATTGCCAGGGGATAGG + Intergenic
981196180 4:141923419-141923441 AATGGTGATTGCCAGGGGATAGG - Intergenic
981202742 4:142000619-142000641 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
981361513 4:143851065-143851087 GATGGTTGTCTCCAGAGGGTAGG + Intergenic
981372258 4:143972059-143972081 GATGGTTGTCTCCAGAGGGTAGG + Intergenic
981381336 4:144075258-144075280 GATGGTTGTCTCCAGAGGGTAGG + Intergenic
982365446 4:154572988-154573010 AATGGTAGTTGCCAGGGGATGGG - Intergenic
982860787 4:160446369-160446391 AATGGTGATTTCCAGGAGATGGG - Intergenic
983458796 4:168000761-168000783 AATGGTGATTGCCAGGTGATGGG + Intergenic
985173956 4:187181322-187181344 GATGGTTTTTTCCAGGTGAAGGG + Intergenic
987147535 5:15006825-15006847 GATGGTTCTCTCCAGAGGATGGG + Intergenic
987358834 5:17088338-17088360 GATGACAATTTCCAGGAGATAGG - Intronic
988222116 5:28361061-28361083 TATAGTGATTGCCAGGGGATAGG + Intergenic
988929776 5:36026429-36026451 ACTGGTTATCTCCAGGGGCTGGG - Intergenic
989469466 5:41798395-41798417 GCTGGTTAACTCCAGCGGATAGG + Intronic
989658432 5:43771018-43771040 TATGGATATTTCTAAGGGATAGG + Intergenic
989751264 5:44896512-44896534 AATGGTGGTTGCCAGGGGATGGG - Intergenic
989954447 5:50341052-50341074 AATGGTAGTTTCCAGGGGCTGGG + Intergenic
990245698 5:53861374-53861396 AATGGTGGTTGCCAGGGGATGGG - Intergenic
990801055 5:59603725-59603747 AATGGTAATTACCAGGGGCTGGG + Intronic
991515031 5:67425786-67425808 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
991642807 5:68771353-68771375 GCTGCTTATTTCCACGGGAGTGG - Intergenic
993854268 5:93053705-93053727 AATGGTTATTTCCGGATGATGGG + Intergenic
994907900 5:105864572-105864594 TATTTTTATTTCCATGGGATTGG - Intergenic
994954265 5:106507182-106507204 AATGGTTATTACCAGAGGCTGGG + Intergenic
995149136 5:108822016-108822038 AATGATGATTGCCAGGGGATAGG - Intronic
995629323 5:114116225-114116247 GAGGGTCATTGCCAGAGGATGGG + Intergenic
995689457 5:114807782-114807804 AATGGTTATCTCCAGAGGTTGGG + Intergenic
995964391 5:117886541-117886563 AATGGTGGTTTCCAGGGGCTGGG - Intergenic
996293614 5:121885138-121885160 GATGGTAGTTACCAGGAGATGGG + Intergenic
998767636 5:145505968-145505990 AATGGTGGTTTCCAGGGGCTGGG + Intronic
998819510 5:146045495-146045517 GATGATAATTTCCAAGGGTTGGG - Intronic
999482056 5:151957733-151957755 GCTGGTGATTGCTAGGGGATTGG + Intergenic
999831152 5:155321389-155321411 TGTGGTTATTTCCAAGGGAGGGG + Intergenic
1000717506 5:164664443-164664465 AATGGTGGTTTACAGGGGATGGG + Intergenic
1002883728 6:1275306-1275328 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
1002910572 6:1488159-1488181 AATGGGTATTGCCAGGGGCTGGG + Intergenic
1003336630 6:5179441-5179463 AATGGTGATTGCCAGGGGCTGGG - Intronic
1003405850 6:5826703-5826725 GATGGTGGTTACCAGGGGTTGGG + Intergenic
1003587523 6:7406496-7406518 AATGGTGATTGCCAGGGGATGGG - Intronic
1003650721 6:7957837-7957859 AAAGGTCATTTCCAGGGGCTGGG + Intronic
1003727502 6:8781835-8781857 AATGGTTATTACCAGAGGCTGGG - Intergenic
1004210809 6:13640716-13640738 AATGGTGGTTTCCAGGGGCTAGG + Intronic
1004321107 6:14632373-14632395 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
1004361312 6:14973665-14973687 AATGGTGATTGCCAGGGGCTGGG + Intergenic
1004644001 6:17542109-17542131 AATGGTAATTGCCAGGGGCTGGG - Intronic
1004777025 6:18859020-18859042 AATGGTGATTGCCAGGGGCTGGG - Intergenic
1005317164 6:24614322-24614344 GCTGGATATTTCCAGGGTATGGG - Intronic
1007456741 6:41983963-41983985 AATGGTGGTTGCCAGGGGATTGG - Intronic
1007929937 6:45681303-45681325 GATGGTGGTTGCCAGGGGATGGG + Intergenic
1008513927 6:52301695-52301717 AATGGTGATTACCAGGGGCTAGG - Intergenic
1008934122 6:56971144-56971166 AATGGTGATTGCCAGGGGCTAGG - Intronic
1009482140 6:64172392-64172414 AATGGTGGTTTCCAGGGGCTAGG - Intronic
1009738979 6:67719669-67719691 GATGGTTATTTCTTGGAGGTTGG - Intergenic
1011091736 6:83610428-83610450 AATGGTGGTTGCCAGGGGATCGG + Intronic
1011714077 6:90085999-90086021 AATGGTGGTTGCCAGGGGATGGG - Intronic
1011940358 6:92835190-92835212 GTTCATCATTTCCAGGGGATGGG - Intergenic
1012704313 6:102501787-102501809 GATGGTGATTTCCAGGGGCCAGG - Intergenic
1012801478 6:103834587-103834609 AATGGTGATTACCAGGGGCTAGG - Intergenic
1012907482 6:105084922-105084944 AATGGTTATTTCTAGGCGATGGG - Intergenic
1013641607 6:112088259-112088281 GATGGGTATTTAGATGGGATAGG + Intronic
1014103824 6:117540998-117541020 GATGTTTCTTCCGAGGGGATGGG - Exonic
1014345283 6:120262675-120262697 AATGGTGATTACCAGGGGCTGGG + Intergenic
1015301794 6:131660897-131660919 GATGGTGGATTCCAGGGGCTGGG - Intronic
1015469134 6:133583578-133583600 AATGGTGATTTCCAGGGCATGGG + Intergenic
1016112668 6:140245015-140245037 GATTGTTATTGGCAGGGGCTGGG + Intergenic
1017366999 6:153654941-153654963 CCTGGGTATTTGCAGGGGATTGG - Intergenic
1017401076 6:154063668-154063690 GATGGTGATTACCAGGGTTTGGG - Intronic
1017469820 6:154728550-154728572 AATGGTAGTTTCCAGGGGTTGGG - Intergenic
1018549997 6:164984851-164984873 GATAGTGGTTTCCAGGGGCTTGG - Intergenic
1019035382 6:169051432-169051454 GATGGTAGTTGCCAGGGGCTGGG - Intergenic
1019682626 7:2360072-2360094 GATGGCCATTCACAGGGGATGGG - Intronic
1019912440 7:4108842-4108864 GTTGGTGGTTGCCAGGGGATGGG - Intronic
1021644156 7:22771425-22771447 AATGATGATTGCCAGGGGATGGG + Intergenic
1022385702 7:29897002-29897024 GAAGGGTATTGCCAGGGGCTGGG - Intronic
1022689207 7:32629562-32629584 GATGGTGGTTTCCAGGGGCTGGG + Intergenic
1022751102 7:33226865-33226887 AATGGTGGTTTCCAGGGGCTTGG + Intronic
1022759555 7:33333001-33333023 AATGGTGGTTTCCAGGGGCTGGG - Intronic
1023104400 7:36749412-36749434 AATGGTGGTTTCCAGGGGCTTGG + Intergenic
1023235756 7:38084545-38084567 GATGGTTAGCTCCAGGTGAGGGG - Intergenic
1023292706 7:38685098-38685120 AATGGTGATTACCAGGGGTTAGG + Intergenic
1024331516 7:48160047-48160069 GATGGTTATTTACAGAGAAAGGG + Intergenic
1026542532 7:71292871-71292893 GATGCTAATTTCCAGAGGATGGG - Intronic
1029095104 7:98078861-98078883 AATGGTGATTACCAGGGGCTAGG + Intergenic
1030347552 7:108451769-108451791 GATGTTTGTTGCCAGGGGCTGGG + Intronic
1031508932 7:122624815-122624837 CATGGTTCTATCCAGGGGCTTGG - Intronic
1031805378 7:126301155-126301177 AATGGTGGTTTCCAGGGGCTGGG - Intergenic
1031826047 7:126567064-126567086 GATGGATGTTGCCAGGGAATGGG + Intronic
1031877737 7:127161001-127161023 GATGGTTATTTCTGGATGATGGG + Intronic
1032132888 7:129245521-129245543 AATGGTGATTTCCAGGGGCTGGG - Intronic
1032423998 7:131805952-131805974 AATGGTGGTTGCCAGGGGATGGG - Intergenic
1032543482 7:132723588-132723610 GAGGGTTGTTGCCAGGGGCTGGG + Intronic
1032919020 7:136525371-136525393 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
1033537477 7:142325241-142325263 AATGGTGATTTCCAAGGGCTAGG - Intergenic
1033543378 7:142377489-142377511 GAAGGTAATTTCCAAGGGCTGGG - Intergenic
1034083306 7:148300840-148300862 GATGGTGACTGCCAGGGGCTGGG + Intronic
1034095431 7:148403702-148403724 GATGTTTGTTCCCAGGGGAAAGG + Intronic
1034402651 7:150875572-150875594 GTTAGGGATTTCCAGGGGATGGG + Intergenic
1034904994 7:154936159-154936181 AATGGTGGTTTCCAGGGGCTGGG - Intronic
1035205049 7:157289728-157289750 GACGGTTTTCTCCAGGGGACTGG + Intergenic
1035380379 7:158435896-158435918 AATGGTGGTTTCCAGGGGCTGGG + Intronic
1035479203 7:159168646-159168668 GATGGTTGTTACCAGGGGCTGGG + Intergenic
1035527151 8:322955-322977 GCTGTTTATTTCCAGGAGAGAGG + Intergenic
1036991812 8:13606833-13606855 AATGCTTATTTCCAGGTGATGGG + Intergenic
1038070078 8:24003977-24003999 GATGGTTATGGCCTGGGGAGAGG + Intergenic
1038397262 8:27256183-27256205 GATGGGATTTTCCAGGGGCTGGG + Intronic
1038943628 8:32332955-32332977 GATGGTTATTTCAGGGTCATGGG - Intronic
1039775466 8:40732038-40732060 AATGGTGATTGCCAGGGGCTGGG + Intronic
1042469579 8:69169162-69169184 CATGGTGGTTACCAGGGGATGGG - Intergenic
1042682675 8:71403861-71403883 ACTGGTTATTTCAAGAGGATGGG + Exonic
1042912580 8:73843149-73843171 GCTGGTGATTGCCAGGGGCTGGG + Intronic
1043133359 8:76489483-76489505 AATGGTGATTACCAGGGGCTGGG - Intergenic
1043763630 8:84101232-84101254 GATGGTTATTTCCTGTGATTTGG + Intergenic
1045976489 8:108135271-108135293 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
1045980247 8:108177698-108177720 AATGGTGATTACCAGGGGCTGGG + Intergenic
1046428516 8:114088720-114088742 AATGGTGGTTTCCAGGGCATAGG - Intergenic
1046873839 8:119231891-119231913 AATGGTGATTACCAGGGTATGGG + Intronic
1047356652 8:124128539-124128561 AATGGTGATTTCCAGGGGCTAGG - Intergenic
1048020235 8:130531649-130531671 AATGGTGGTTTCCAGGGGCTGGG - Intergenic
1050191860 9:3034661-3034683 GATGGTTATTTCAAAGTAATGGG - Intergenic
1050248048 9:3712950-3712972 CATGGTCACTGCCAGGGGATGGG - Intergenic
1050565962 9:6883860-6883882 CATGGATATTTCAAGGGGGTGGG + Intronic
1051482256 9:17573743-17573765 GATGCCAATTCCCAGGGGATTGG + Intergenic
1051515598 9:17927071-17927093 TATGGTGGTTGCCAGGGGATAGG - Intergenic
1051576502 9:18622156-18622178 GAGGGTTATTTCATGGTGATTGG + Intronic
1051804071 9:20971770-20971792 AATGGTGGTTACCAGGGGATAGG - Intronic
1055715202 9:79109964-79109986 AATGGTGATTTCCAGGGGCTGGG + Intergenic
1056052011 9:82778867-82778889 CATTGTTATTTCCAGGAAATAGG - Intergenic
1056286748 9:85094822-85094844 AATGGTGGTTTCCAGGGGCTGGG + Intergenic
1056807849 9:89742760-89742782 GATGGTGGTTGCCAGGGGCTGGG + Intergenic
1057892993 9:98883446-98883468 AATGGTGATTTCCAGGGCCTTGG - Intergenic
1060578772 9:124724269-124724291 AATGGTTATTTCTAGGTGGTGGG + Intronic
1061523883 9:131141234-131141256 GGTGGTTATTTCTGGGTGATGGG + Intronic
1186208722 X:7227883-7227905 AGTGGTGGTTTCCAGGGGATAGG - Intronic
1186311244 X:8322102-8322124 GATGGTGGTTACCAGGGGCTGGG + Intergenic
1186477550 X:9869483-9869505 AATGGTGATTACCAGGGGCTGGG - Intronic
1186716629 X:12258971-12258993 AATGGTGATTACCAGAGGATAGG - Intronic
1187621962 X:21066373-21066395 AATAGTTGTTTCCAGGGGTTAGG - Intergenic
1188559637 X:31453101-31453123 AATGGTGGTTTCCAGGGGCTGGG + Intronic
1189151791 X:38716619-38716641 GATGCTGGTTACCAGGGGATTGG - Intergenic
1189515914 X:41713361-41713383 GGAGGTTATTTCCAAGGGAATGG + Intronic
1189779966 X:44504876-44504898 AATGGTTATCTCTATGGGATGGG - Intergenic
1189892157 X:45614465-45614487 AATGGTTGTTGCCAGGGGTTAGG + Intergenic
1190014981 X:46819159-46819181 CATGGCTACTGCCAGGGGATGGG - Intergenic
1190776961 X:53560384-53560406 TAGGGATATTTCCTGGGGATGGG + Exonic
1191197046 X:57735972-57735994 CATGGTCACTGCCAGGGGATGGG - Intergenic
1192593530 X:72382713-72382735 ATTGGTTGTTTCCAGGGGGTCGG + Intronic
1192958915 X:76105024-76105046 CATGGTTGCTGCCAGGGGATGGG + Intergenic
1193440942 X:81538592-81538614 TATGGTTGCTACCAGGGGATGGG - Intergenic
1194207241 X:91026376-91026398 AATGGTAGTTGCCAGGGGATGGG + Intergenic
1194473801 X:94334393-94334415 CATGCTTATGACCAGGGGATTGG - Intergenic
1194816876 X:98453015-98453037 AATGGTGGTTTCCAGGGGCTGGG - Intergenic
1195712244 X:107782627-107782649 GATGGTGGTTACCAGGGGTTGGG - Intronic
1196161740 X:112492388-112492410 AATGGTGATTGCCAGGGGCTGGG + Intergenic
1198447567 X:136733428-136733450 GATGGTTAGCTCTAGGTGATTGG - Intronic
1198729190 X:139709086-139709108 AATGGTGGTTTCCAGAGGATGGG - Intergenic
1199741857 X:150742954-150742976 AATGGTCATTGCCAGGGGCTAGG + Intronic
1199854188 X:151746482-151746504 AATGGTTGCTTCCAGGGGCTGGG - Intergenic
1200015298 X:153157837-153157859 CATGGTGATTGCCAGGGGCTAGG + Intergenic
1200552983 Y:4601123-4601145 AATGGTAGTTGCCAGGGGATGGG + Intergenic
1201961315 Y:19683230-19683252 GAAGGTGATTTCTGGGGGATAGG + Intergenic