ID: 1150894983

View in Genome Browser
Species Human (GRCh38)
Location 17:69199087-69199109
Sequence TGCCATATCCCCTGTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150894977_1150894983 28 Left 1150894977 17:69199036-69199058 CCTTGTGTTCCCTATACATACAC 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1150894983 17:69199087-69199109 TGCCATATCCCCTGTGTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 145
1150894979_1150894983 18 Left 1150894979 17:69199046-69199068 CCTATACATACACACTGTGTCTT 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1150894983 17:69199087-69199109 TGCCATATCCCCTGTGTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 145
1150894978_1150894983 19 Left 1150894978 17:69199045-69199067 CCCTATACATACACACTGTGTCT 0: 1
1: 0
2: 1
3: 13
4: 219
Right 1150894983 17:69199087-69199109 TGCCATATCCCCTGTGTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150894983 Original CRISPR TGCCATATCCCCTGTGTGGA AGG Intronic
900486380 1:2924683-2924705 TGCCATGTCCCCTGTCTGAGAGG + Intergenic
900795145 1:4703312-4703334 GGCCATGTCCCCTGAGTAGAGGG + Intronic
902404930 1:16177420-16177442 TTCCTTGTCCCCTGTGTGCAAGG + Intergenic
902697673 1:18151107-18151129 GGCTGTATCCTCTGTGTGGAGGG + Intronic
902954165 1:19913439-19913461 AGCCAGAGCCCTTGTGTGGATGG - Intergenic
904445529 1:30570618-30570640 AGGTATGTCCCCTGTGTGGAGGG + Intergenic
906949983 1:50326719-50326741 TGCCAGTGCCCCTGGGTGGAGGG - Intergenic
907258182 1:53196269-53196291 TGCCAGCTCACCTGAGTGGATGG - Intergenic
908231582 1:62110792-62110814 TACCACATCCCTTGGGTGGAAGG - Intronic
912074773 1:105860144-105860166 TGCCATATGCTTTTTGTGGATGG - Intergenic
913230470 1:116736787-116736809 TGCCATTTCCTCTGCCTGGAAGG + Intergenic
914847856 1:151292732-151292754 TTCCATTTCCCTTGGGTGGATGG + Exonic
920986800 1:210898276-210898298 TGACAGATCCCCAGTGTGGTGGG - Intronic
1063150362 10:3331424-3331446 TGCGATCCCCCCGGTGTGGATGG + Intergenic
1065277670 10:24101874-24101896 TGACATATCCAGTGAGTGGAAGG + Intronic
1068938176 10:62656414-62656436 TGCTATTTCCCTTTTGTGGAGGG + Exonic
1070371930 10:75790862-75790884 TGCAATATCCTCTGTGGGGAAGG + Intronic
1073798896 10:107019642-107019664 TGGCATTTCCCCTGCTTGGACGG - Intronic
1076107180 10:127832847-127832869 TAACATATCTGCTGTGTGGAAGG + Intergenic
1076260797 10:129064133-129064155 TGCAATTTCTTCTGTGTGGATGG + Intergenic
1076437080 10:130453836-130453858 TGACACAGCCCCTGGGTGGAAGG - Intergenic
1078289905 11:9998630-9998652 TTACATATCCCCTGTCTTGAAGG - Intronic
1081777095 11:45683078-45683100 GGACAGATCCCCTGTGGGGATGG - Intergenic
1082079058 11:47997734-47997756 GGGCATATCTCTTGTGTGGAAGG - Intronic
1085296628 11:75435164-75435186 TGCCATACCCCCTGTGGCAATGG - Exonic
1088557331 11:111075119-111075141 TCAAATATCCCCTGGGTGGAAGG - Intergenic
1089761070 11:120723707-120723729 TGTCCTATCCACTGTGAGGAAGG - Intronic
1093880975 12:24404471-24404493 TGCCATTTCCCCTTTGTGCAAGG + Intergenic
1097101907 12:56595793-56595815 TTCCATACCCTCTGTGTGGATGG - Exonic
1105828233 13:24141665-24141687 TTCCATACCCCCTGCGTGGCAGG - Intronic
1108091273 13:46852464-46852486 TGCCTTAGCCCCTGTGTGTTTGG + Intronic
1112037755 13:95513276-95513298 TTACATATCCCCTGTCTGGCAGG + Intronic
1113206143 13:107918707-107918729 TGCCATATCCAGTGTGTGAAGGG + Intergenic
1114260545 14:21033344-21033366 AGCCATATCCCCTGAGTAGGTGG + Exonic
1117102281 14:52362678-52362700 TTGCATATCTCCTTTGTGGATGG - Intergenic
1119401285 14:74364333-74364355 TGCCAGATCCCTTGTGAGCAGGG - Intergenic
1119428800 14:74552366-74552388 TGCCAGATCCCCTGCCTGAACGG - Exonic
1122458310 14:101874059-101874081 TGCTAGATCCCCTGGGTGGACGG - Intronic
1123981655 15:25610234-25610256 AGCCACAGCCTCTGTGTGGAGGG - Intergenic
1126379057 15:48027370-48027392 TGCCTCAGCCCCTGGGTGGAAGG + Intergenic
1133067132 16:3216292-3216314 TTCCATCTTCCCTTTGTGGATGG - Intergenic
1134210979 16:12276562-12276584 TGCCCTATCAGCTGTATGGAGGG - Intronic
1135177953 16:20247822-20247844 GGCCTTATCCCATCTGTGGAGGG + Intergenic
1137597057 16:49731201-49731223 TGTCATCTCCCCTCTGTGCACGG + Intronic
1146857363 17:36265118-36265140 TCCCCTAGGCCCTGTGTGGAAGG - Intronic
1146863256 17:36323257-36323279 TCCCCTAGGCCCTGTGTGGAAGG + Intronic
1147066116 17:37923845-37923867 TCCCCTAGGCCCTGTGTGGAAGG + Intergenic
1147076155 17:37989654-37989676 TCCCCTAGGCCCTGTGTGGAAGG - Intronic
1147077648 17:38003405-38003427 TCCCCTAGGCCCTGTGTGGAAGG + Intronic
1147087680 17:38069199-38069221 TCCCCTAGGCCCTGTGTGGAAGG - Intergenic
1147093584 17:38127340-38127362 TCCCCTAGGCCCTGTGTGGAAGG + Intergenic
1147103622 17:38193148-38193170 TCCCCTAGGCCCTGTGTGGAAGG - Intergenic
1147609205 17:41791822-41791844 TCCCTTTGCCCCTGTGTGGAGGG - Intergenic
1147886808 17:43689958-43689980 TTCCCTTTTCCCTGTGTGGAGGG - Intergenic
1150334687 17:64321887-64321909 AGCCAGATCCCCTGTGTCCAGGG - Exonic
1150803500 17:68300760-68300782 TGTCATATGCCCCCTGTGGATGG + Intronic
1150894983 17:69199087-69199109 TGCCATATCCCCTGTGTGGAAGG + Intronic
1151988637 17:77559828-77559850 TGCCCCATCCTCTGTGAGGAAGG + Intergenic
1152841687 17:82573225-82573247 TTCCATATTTCCTTTGTGGAGGG + Intronic
1153530619 18:6042097-6042119 GGCCACATCCTCTGTGGGGAGGG - Intronic
1155873648 18:31058082-31058104 TGTCCCATTCCCTGTGTGGAGGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160044141 18:75371116-75371138 TGCCATTGCACCTCTGTGGAGGG + Intergenic
1164180240 19:22811953-22811975 TGCCATGTCACCTGTGTGCTGGG - Intergenic
1164303327 19:23981246-23981268 TGCAATAACCCCTGAGAGGAGGG + Intergenic
1166679985 19:44760038-44760060 TACCATATCCCTTGGGTGCATGG + Exonic
925292927 2:2760424-2760446 TGCCATATTGCCAGTGTGTAAGG - Intergenic
925557882 2:5152480-5152502 TGCCATGTGCCCTCTGTGCATGG + Intergenic
926544823 2:14226597-14226619 TGGCATATCTCCAGTGTGGTAGG + Intergenic
927542490 2:23926197-23926219 GGCCAGAGCCCCTGGGTGGAAGG - Intronic
929545588 2:42853508-42853530 TGCCATGTCTGCTGGGTGGAAGG - Intergenic
930270530 2:49251197-49251219 TGCCATATCCCCATTTTGCAGGG - Intergenic
932323567 2:70839230-70839252 TGCCCTATCCCCTGTGCCCAGGG - Intergenic
932436259 2:71704084-71704106 TGCCATCTCCCCCATATGGAAGG - Intergenic
941706519 2:168664289-168664311 TGCCATCACATCTGTGTGGAAGG - Intronic
942206981 2:173629015-173629037 TGCCATTCCACCTGTCTGGATGG - Intergenic
942866091 2:180676737-180676759 TGCCACATTCACTGGGTGGAAGG - Intergenic
945133935 2:206605778-206605800 GGCCATATTCACTGTGTGGAGGG - Intronic
949034317 2:241809654-241809676 TGTCATATACCCTGGGTAGACGG + Intronic
1169149084 20:3275223-3275245 TGCCAGATTCCCAGGGTGGAAGG + Intronic
1170802033 20:19598465-19598487 TGACATATCTTGTGTGTGGAAGG + Intronic
1171309780 20:24136789-24136811 TGCCATATGCCCTGTGCTGTGGG + Intergenic
1171379394 20:24722695-24722717 TGACATATCCTCTGTCTGGTAGG + Intergenic
1172299941 20:33842334-33842356 TGTCATCTGCCCTGTGTGTATGG - Intronic
1172932450 20:38596092-38596114 AGCCATGTCCCATCTGTGGAAGG - Intergenic
1173257657 20:41406370-41406392 TGCCAGATCACCCGTGTTGAGGG - Intronic
1175034332 20:55985333-55985355 TGCCTATTCCCCTGTGTGGATGG - Intergenic
1175104601 20:56605645-56605667 GGCTATCTCCACTGTGTGGAAGG + Intergenic
1175326575 20:58133289-58133311 TGCCATTTGACCTATGTGGAAGG - Intergenic
1175677421 20:60958783-60958805 TGCCATCTTCCCTGTGTTGCTGG + Intergenic
1176105286 20:63382854-63382876 AGTCAGATGCCCTGTGTGGACGG - Intergenic
1180121039 21:45748347-45748369 CGCCATAGGCCCTGTGTGAATGG + Intronic
1181529046 22:23505740-23505762 TTCCATGTCCACTGTGTGCAGGG - Intergenic
954327978 3:49873926-49873948 GGCCAGATCCCCAGTGAGGATGG + Intergenic
956112142 3:65880420-65880442 TCTCATATCCCCTGTCAGGAAGG + Intronic
960588743 3:119345384-119345406 TGCCATAACCCCAGTGTGCTGGG - Intronic
961390560 3:126550217-126550239 TGGCAGAGCCTCTGTGTGGAAGG - Intronic
961719414 3:128882865-128882887 TGCAATCTCTCCTGTGTGGCAGG + Intronic
963489398 3:145980457-145980479 TCCCATATTCTCTATGTGGAAGG - Intergenic
966053093 3:175646408-175646430 TTCCATATCACTTATGTGGATGG + Intronic
967443222 3:189533434-189533456 TGTCATTTCTCCTCTGTGGAAGG - Intergenic
969562219 4:7956567-7956589 TGCCATTTCCTCTGCCTGGAAGG + Intergenic
969631550 4:8341641-8341663 TGCCCTAACCCCTGTGTGCCTGG + Intergenic
973025292 4:45261331-45261353 TGCCATACCTCCTGTGAGAAGGG - Intergenic
975100496 4:70507728-70507750 TGCCAAATAGCCTGTGTGGGAGG - Intergenic
978190289 4:105903385-105903407 TTCCATCTCCCCTGTGATGAAGG - Intronic
980522010 4:133947696-133947718 TGCAATATCCCCTGTGTTAAAGG - Intergenic
989146024 5:38250882-38250904 TGCCATTTCCGCTCTCTGGATGG + Intergenic
991614614 5:68483028-68483050 TGTCATATCCCCTGTGTACATGG + Intergenic
992066385 5:73113740-73113762 TGCCATTTCCCCAGTGAAGATGG - Intergenic
996894697 5:128466241-128466263 TGACATAATCCCTGTGTGTAAGG - Intronic
1002001843 5:176200442-176200464 TCCCACTTCCCCTGTGTAGAAGG - Intergenic
1002252495 5:177938536-177938558 TCCCACTTCCCCTGTGTAGAAGG + Intergenic
1003762765 6:9198946-9198968 AGCCAAATCTCCTGTGTAGAAGG + Intergenic
1004562831 6:16767217-16767239 TTTCATATCACATGTGTGGAAGG + Intergenic
1004571186 6:16847135-16847157 TGCCTTATCCCCTCAGTTGATGG + Intergenic
1004869326 6:19888840-19888862 TGCCAAGGCCCCAGTGTGGAAGG + Intergenic
1006389206 6:33748745-33748767 TCCCATCTCCACTGTGTGGATGG + Intergenic
1006652579 6:35563798-35563820 TGCCATATCCCTTGGCAGGAAGG - Intergenic
1008296622 6:49786251-49786273 TGGCATATCTCCTGGCTGGATGG - Exonic
1012872118 6:104684890-104684912 TGCCATATCCCCAGAAGGGAGGG - Intergenic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1016750300 6:147624326-147624348 TGCCACATCCCCTGGGGGGTGGG - Intronic
1017886651 6:158605612-158605634 TGCCATTTCACCTGTGTGGAAGG + Intronic
1019514973 7:1435506-1435528 TCCCACATCACCTGTGTGGTCGG - Intronic
1019763328 7:2830477-2830499 AGGCATGTCCCCTGTGGGGAGGG + Intronic
1019937300 7:4264947-4264969 TGCCTGCTCTCCTGTGTGGAGGG + Intronic
1023606298 7:41934258-41934280 TGTCATATACCTTATGTGGAAGG - Intergenic
1023931495 7:44709097-44709119 TGCCTTCTCCCCTGAGGGGATGG + Intergenic
1024307624 7:47941367-47941389 AGCCACATCCCCTGTGAGGATGG - Intronic
1024446282 7:49483496-49483518 AGCCATCTCCACTGTGGGGAAGG + Intergenic
1025156728 7:56613759-56613781 TGCAATATCACCTGTGGGCAAGG + Intergenic
1025250284 7:57347248-57347270 TGCCTGAACACCTGTGTGGAGGG + Intergenic
1026523295 7:71134084-71134106 TCTCATTTCCCCTCTGTGGATGG - Intronic
1028197129 7:87920236-87920258 TGCCATGGCCACTGTGGGGATGG - Intergenic
1028726171 7:94090352-94090374 GGCCAAATGCCCTGTGTGGATGG + Intergenic
1033259638 7:139831590-139831612 TGCCATCTCACCTGGCTGGATGG - Intronic
1034458962 7:151187543-151187565 TGCCAGGTCCCCGGTGTAGAGGG + Intronic
1034744702 7:153513567-153513589 TGCCTTATCCCTTGTATGGGAGG - Intergenic
1035123449 7:156589446-156589468 TGGCAGATAGCCTGTGTGGATGG - Intergenic
1035333159 7:158109474-158109496 TGACATCACCCCTGTGTGAAGGG + Intronic
1035925111 8:3719750-3719772 TTCCATTCCTCCTGTGTGGAAGG + Intronic
1036614385 8:10377475-10377497 AGCCATATCCTTTGGGTGGATGG + Intronic
1038378311 8:27065742-27065764 TGCCCTATTCCCTTTCTGGATGG - Intergenic
1040763709 8:50880879-50880901 AGCCATATCCCATGTGGGGGAGG - Intergenic
1040779171 8:51086854-51086876 TTCCAGATCTCCTGTTTGGAAGG - Intergenic
1041164010 8:55073250-55073272 TGCCAGATCCACTGCATGGATGG + Intergenic
1042787976 8:72571088-72571110 TGCCAGATCCCTAGTATGGAAGG + Intronic
1043827823 8:84950025-84950047 TGTCACCTCCACTGTGTGGATGG - Intergenic
1047665073 8:127082666-127082688 TGCCATATCCCCAGTGGAGATGG - Intergenic
1048991676 8:139764152-139764174 TGACACATCCACTGTCTGGATGG + Intronic
1058976608 9:110130813-110130835 TGGCATATCCCCTTTATGAAAGG + Intronic
1061255067 9:129450480-129450502 TTCCATGTCCACTGTGTGCAAGG + Intergenic
1189139512 X:38587026-38587048 TCAAATATCCCCTGTGGGGAAGG - Intronic
1189241109 X:39525335-39525357 TGCCATTCCCCCTCTCTGGAAGG - Intergenic
1190473178 X:50802916-50802938 TGTCATATTGCTTGTGTGGATGG - Intronic
1191011740 X:55767166-55767188 TGCCAGATCCCCTGTCAGAAAGG - Intergenic
1191973860 X:66848736-66848758 TGACATATTCAATGTGTGGAAGG - Intergenic
1193076482 X:77361322-77361344 TACCATATACCCTGCTTGGATGG - Intergenic
1201736365 Y:17266710-17266732 TGACATCTCCCCTGTGTAAATGG + Intergenic