ID: 1150901420

View in Genome Browser
Species Human (GRCh38)
Location 17:69282289-69282311
Sequence CAGTGGAGAAGGAGCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 814
Summary {0: 1, 1: 0, 2: 15, 3: 123, 4: 675}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150901420_1150901424 -10 Left 1150901420 17:69282289-69282311 CCCTCTTGGCTCCTTCTCCACTG 0: 1
1: 0
2: 15
3: 123
4: 675
Right 1150901424 17:69282302-69282324 TTCTCCACTGCTCACCCAGGAGG 0: 1
1: 0
2: 3
3: 27
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150901420 Original CRISPR CAGTGGAGAAGGAGCCAAGA GGG (reversed) Intronic
900429154 1:2593751-2593773 CCGCGGAGAAGCAGCCAGGAAGG - Intronic
900687113 1:3955630-3955652 CTGTGGGAAAGGAGCCAATAAGG - Intergenic
900814027 1:4829552-4829574 TATTGGAGAAGGAGTCAAGATGG + Intergenic
900895628 1:5481069-5481091 CTGTGGTGAAGGAGCCACGCAGG - Intergenic
900998763 1:6136924-6136946 CAGGAGACAAAGAGCCAAGAAGG + Intronic
901919350 1:12525401-12525423 CAGGGGAGGAGGATCCAGGAAGG + Intergenic
902311839 1:15587064-15587086 CAGCCGAGAAGGAGCCACGAAGG - Intronic
903298885 1:22363880-22363902 CTGTGGACAAGGAGCCAACTGGG + Intergenic
904001569 1:27341896-27341918 CAGTGGAGCTGGGGCCAAGCTGG + Intergenic
904750823 1:32740849-32740871 CAGCGGGAGAGGAGCCAAGATGG - Intergenic
905307559 1:37030058-37030080 CAGTTGAGAAGGAGGAAAGCTGG + Intronic
905740409 1:40365523-40365545 CATTCGGGGAGGAGCCAAGATGG + Intronic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
905952510 1:41964108-41964130 TTGTGGAGGAGGGGCCAAGATGG + Intronic
906084618 1:43120499-43120521 AAGTCGGGGAGGAGCCAAGATGG - Intergenic
906561668 1:46762710-46762732 CAGAGAAGAAGGAGCCAGTAAGG + Intronic
906828365 1:49006009-49006031 AAAGGGAGGAGGAGCCAAGATGG + Intronic
906851706 1:49257803-49257825 CCGTGCTGGAGGAGCCAAGATGG - Intronic
906858160 1:49330761-49330783 AAGGGGTGAAGGGGCCAAGATGG + Intronic
907051313 1:51331222-51331244 CAGGGGAGAGGGGGCCAAGGGGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
907586042 1:55618837-55618859 CTGTGAAGAAAGAGCCAAGCAGG - Intergenic
907668945 1:56457857-56457879 AAGTTGCGAAGGAGCCAAGGGGG - Intergenic
907863801 1:58379188-58379210 CTGGGGGGGAGGAGCCAAGATGG - Intronic
908514526 1:64878979-64879001 CAGTGCAGAGGGAGCCAGGCAGG + Intronic
908686504 1:66725914-66725936 CAGTGGAGAAGGTGTGAACATGG + Intronic
908690628 1:66775596-66775618 AAGTGGATTAGGAGCCAGGATGG + Intronic
908881710 1:68740118-68740140 CTTTGGGGGAGGAGCCAAGATGG - Intergenic
908898035 1:68923483-68923505 CACCGGAGGAGGAGCCAAGATGG + Intergenic
908975216 1:69888625-69888647 CTCAGGAGGAGGAGCCAAGATGG - Intronic
909114147 1:71513694-71513716 CAGCAGAGGAGGAGCCAAGATGG + Intronic
909134510 1:71780980-71781002 CAGTGGAGAATAATCCAAAATGG - Intronic
910319425 1:85927064-85927086 AGGGGGAGGAGGAGCCAAGACGG + Intronic
910636939 1:89418597-89418619 TAAAGGAGGAGGAGCCAAGATGG - Intergenic
911299924 1:96159405-96159427 CAGTGGATAACCAGCCAATATGG + Intergenic
911456329 1:98128818-98128840 CAGTGGAGAAGATGACAAAAGGG - Intergenic
911988856 1:104664854-104664876 AATAGGAGGAGGAGCCAAGATGG - Intergenic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912448895 1:109757863-109757885 CCTGGGAGAAGGGGCCAAGACGG + Exonic
912743174 1:112221415-112221437 TAAAGGAGGAGGAGCCAAGATGG + Intergenic
913299815 1:117358708-117358730 CAGAGCGGGAGGAGCCAAGATGG - Intergenic
913335949 1:117709127-117709149 CAGTGGAGAGGGGCCCAAGGCGG - Intergenic
914401800 1:147327796-147327818 AAGGGGGGGAGGAGCCAAGATGG - Intergenic
914410540 1:147423215-147423237 CCTTGGGGGAGGAGCCAAGATGG + Intergenic
914755995 1:150561913-150561935 GAGTGGGGAAGGAGGCAAAAGGG + Intergenic
915066665 1:153230709-153230731 CAGTGGAGACAAAGACAAGAGGG + Intergenic
915604381 1:156941503-156941525 CAATGGAGTAGGATCCGAGAAGG + Intronic
915624301 1:157105542-157105564 CAGTCGAGAGGGAGCCTGGAGGG - Intergenic
915808913 1:158886100-158886122 CCGAGGAGGAGGAGCCAAGATGG + Intergenic
915861789 1:159452950-159452972 TTTTGGAGGAGGAGCCAAGATGG + Intergenic
916019976 1:160783077-160783099 ATGTGGGGGAGGAGCCAAGATGG + Intergenic
916359055 1:163947213-163947235 CAGTAGTGAAAGAGCCCAGAAGG + Intergenic
916903684 1:169257573-169257595 CAGAGGGGGAGGAGCCAAGATGG - Intronic
917182423 1:172314243-172314265 CACAGGGGGAGGAGCCAAGATGG + Intronic
917478763 1:175392103-175392125 AAGAGAAGAAGGAGACAAGAGGG + Intronic
917691694 1:177476588-177476610 CAGTGAGGAAGGAGTCAACAAGG + Intergenic
918185959 1:182128051-182128073 AAGTGGAGAAGGCAGCAAGAAGG + Intergenic
918302535 1:183217002-183217024 CAGTAGAGAGGGAGCTAAGAAGG + Intronic
918315537 1:183319626-183319648 CAGAGGAGAAGAAGGAAAGAAGG - Intronic
918483159 1:185001526-185001548 CAGTAGAGGAGGAGCCAAGATGG + Intergenic
918855739 1:189754798-189754820 TACTGGGGGAGGAGCCAAGATGG + Intergenic
919335492 1:196225384-196225406 AAAGGGAGGAGGAGCCAAGATGG - Intergenic
919499258 1:198315444-198315466 ATGGGGAGGAGGAGCCAAGATGG - Intronic
920604736 1:207370926-207370948 CAGTGGAAAAGGACCCAACTGGG + Intergenic
920622937 1:207566272-207566294 AAGGGGAGAAGGAGAGAAGAAGG - Intronic
920995696 1:210988413-210988435 CATAGGGGGAGGAGCCAAGATGG - Intronic
921184503 1:212658016-212658038 CATTGCAGATGGAGCCAAGATGG + Intergenic
922726588 1:227925660-227925682 CAGGGGAGAGGGAGGCGAGAAGG + Intronic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
923751824 1:236753830-236753852 GAGTGGAGAAGGAGAAACGAAGG - Intronic
923990227 1:239427708-239427730 CAGAGGAGACTGAGACAAGATGG + Intronic
924557362 1:245129551-245129573 CAGTGGAGAAGGGACCGGGAAGG + Intergenic
924894142 1:248317399-248317421 TACTGGAGGAGGGGCCAAGATGG - Intergenic
1063294527 10:4791267-4791289 CAGGGAAGCAGGAGCCAAGGAGG - Intronic
1063308842 10:4933817-4933839 CAGAGGAAAAGGAGGAAAGACGG - Intronic
1063451232 10:6151664-6151686 CAGTGGAGAAAGATCCAATCAGG + Intronic
1063524293 10:6770193-6770215 CAGTGGACAAGGGGACAAGGCGG - Intergenic
1063597613 10:7451160-7451182 GAGAGGAGAAAGGGCCAAGAGGG - Intergenic
1064011150 10:11737450-11737472 AAGTTCAGGAGGAGCCAAGATGG - Intergenic
1064024194 10:11833862-11833884 CAGTGATGAAGGAGTCACGAAGG + Intronic
1064384243 10:14877099-14877121 CTGAGGAAAAGGAGCCAAAAAGG + Intergenic
1065278255 10:24108066-24108088 GAGGGAAGAAGTAGCCAAGAAGG + Intronic
1065313351 10:24437541-24437563 CAGTGTAGACAGAGCCAAAAGGG + Intronic
1065985564 10:30948022-30948044 CAGCTGCGGAGGAGCCAAGATGG - Intronic
1066044563 10:31584187-31584209 CAGTGGAGGGGAAGCCAGGATGG + Intergenic
1066930197 10:41749401-41749423 TAGTGGAGGAGGAGCCAAGATGG + Intergenic
1067195320 10:44112880-44112902 CATTAGAGGTGGAGCCAAGATGG - Intergenic
1067785815 10:49246132-49246154 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
1067955740 10:50788569-50788591 ATGCGGAGGAGGAGCCAAGATGG - Intronic
1068202324 10:53797827-53797849 AAGGGGTGGAGGAGCCAAGATGG - Intergenic
1068333406 10:55601872-55601894 CACGGGGGGAGGAGCCAAGATGG + Intronic
1069984925 10:72276528-72276550 CACTGGACAAGGAACCAAGAGGG + Intergenic
1070656909 10:78277939-78277961 GAGTGGAGAAGGCTCCAGGAGGG + Intergenic
1070892956 10:79956162-79956184 AAATGGGGATGGAGCCAAGATGG + Intronic
1070976791 10:80611727-80611749 CAGTGGAGAAGGTGCGACCAAGG + Intronic
1071072364 10:81709608-81709630 TAGGGGGGGAGGAGCCAAGATGG + Intergenic
1071105542 10:82089889-82089911 CACTGGGGCAGGAGCCTAGAAGG - Intronic
1071114776 10:82205229-82205251 AGGTAGAGAAGGAACCAAGATGG - Intronic
1071248133 10:83787069-83787091 AAGAGGGGGAGGAGCCAAGATGG - Intergenic
1071354431 10:84779244-84779266 GTTTGGAGGAGGAGCCAAGATGG - Intergenic
1071904675 10:90159461-90159483 CAGGAGGGGAGGAGCCAAGATGG - Intergenic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072842401 10:98788953-98788975 TATAGGAGGAGGAGCCAAGATGG - Intronic
1073640653 10:105249432-105249454 CAGAGGAGAAAGATCCAGGAAGG + Intronic
1073651961 10:105370482-105370504 AAGTGGAGAAGGAACAAAAAAGG - Intergenic
1073653197 10:105383359-105383381 TAGGGGGGGAGGAGCCAAGATGG - Intergenic
1073848327 10:107585486-107585508 CTGTGGAGAGGGGGCCCAGAAGG + Intergenic
1074030989 10:109687696-109687718 AAATGGAGGTGGAGCCAAGATGG - Intergenic
1074044588 10:109825814-109825836 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
1074282104 10:112062387-112062409 CAGGAGGGGAGGAGCCAAGATGG + Intergenic
1074286626 10:112103922-112103944 TGGTGGGGGAGGAGCCAAGATGG + Intergenic
1074371086 10:112901308-112901330 GAGAGGAGAAGGAGCCAAACTGG - Intergenic
1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG + Intronic
1074809171 10:117085045-117085067 CCCTGGGGGAGGAGCCAAGATGG - Intronic
1075433013 10:122405764-122405786 CAGTGGAGTAGAAGCCACCATGG + Intronic
1075516055 10:123109202-123109224 TAGAGGAGATGGAGGCAAGAAGG + Intergenic
1075518914 10:123132409-123132431 CTTGGGACAAGGAGCCAAGAGGG - Intergenic
1076932912 10:133545755-133545777 AAGTGGGGGAGGGGCCAAGATGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077475453 11:2788192-2788214 CTGTGGAGAAGGAGCCCAGGAGG - Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077591918 11:3499033-3499055 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1077794481 11:5477495-5477517 TATTGGGGGAGGAGCCAAGATGG + Intronic
1077827670 11:5827968-5827990 AAGTAGAGAAGGAGCCAACTAGG + Intronic
1078156822 11:8806943-8806965 AAGTGGAGAAGGGGCCAGGAGGG - Intronic
1078349031 11:10577353-10577375 CAGTTGGGAAGGAATCAAGAGGG - Intronic
1078412824 11:11141695-11141717 CTGTGGAGCAGGAGGCAATAAGG - Intergenic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078448551 11:11423594-11423616 CAGTGAAGTAGGAGACAAAAAGG - Intronic
1078976110 11:16479236-16479258 CAATGCACAAGGGGCCAAGAGGG + Intronic
1079577585 11:22022003-22022025 CAAGGGAGGAGGAGCCAAGATGG - Intergenic
1079961668 11:26931906-26931928 AAGTGGAGAAGAGGGCAAGAAGG + Intergenic
1080005903 11:27406095-27406117 CAGAGGAGCATGAGCAAAGATGG - Intronic
1080091492 11:28354095-28354117 CATTGGAGCAGGAGCTGAGAGGG + Intergenic
1080907171 11:36557619-36557641 AAGTTGAGGAGGAGCCAAGATGG - Intronic
1081655188 11:44852610-44852632 CACTGGAGAGAGAGCCAAGGGGG - Intronic
1082152011 11:48750697-48750719 AAGTGGGGGAGGAGCCAAGATGG - Intergenic
1082158383 11:48853706-48853728 ATGTGGGGGAGGAGCCAAGATGG - Intergenic
1082953490 11:58843845-58843867 CAACAGAGTAGGAGCCAAGAAGG + Intronic
1082969892 11:59009105-59009127 CAATAGAGTAGGAGCCAAGAAGG + Intronic
1083460297 11:62806656-62806678 CAGGGGAGCAGGATCCCAGAGGG - Intergenic
1083593175 11:63907025-63907047 CAGGGGTGAAAGAGCCAGGAAGG - Intronic
1084090352 11:66875547-66875569 CCGAGGAGGAAGAGCCAAGAAGG + Intronic
1084247757 11:67871769-67871791 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1085156020 11:74295050-74295072 CACGGGGGGAGGAGCCAAGATGG - Intronic
1085280207 11:75325123-75325145 CAGTGGGGGAGGTGCCAACATGG + Intronic
1085636255 11:78161625-78161647 CAGTGAGGAAGGGGCTAAGAGGG - Intergenic
1086240707 11:84686878-84686900 CAGCAGAGTAGGAGCCAAGGAGG - Intronic
1086786189 11:90972284-90972306 AACTGGAGGAGGAGCCAAGATGG - Intergenic
1087330831 11:96777802-96777824 GAGCGGGGGAGGAGCCAAGATGG - Intergenic
1087608747 11:100409038-100409060 CGCTGGGGGAGGAGCCAAGATGG + Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088974093 11:114799511-114799533 GAGGGGAGAAGGAGCCAAGGAGG + Intergenic
1089609348 11:119660840-119660862 CAGAGGAGCAGGAGCCCTGAGGG - Intronic
1089738123 11:120563900-120563922 CACTGGAGAGGGGGCCCAGACGG - Intronic
1090719488 11:129458812-129458834 GAGTGGAAAAGGAGGCAGGAAGG - Intergenic
1091028410 11:132161780-132161802 CCGTGGAGAAGCAGCCCAGCAGG - Intronic
1091052234 11:132383416-132383438 AAGGGGAGGTGGAGCCAAGATGG + Intergenic
1091096198 11:132824592-132824614 CAGTGGAGAAGCAGAGATGAAGG - Intronic
1091330377 11:134727295-134727317 CAGTGGTCAAAGAGCCAAGGGGG - Intergenic
1091728458 12:2862385-2862407 GGGTGGAGAGGGAGCCAAAAAGG + Intronic
1091749795 12:3015106-3015128 CAGTGGGGAGGGGGCCAAGGGGG + Intronic
1091824953 12:3505210-3505232 TTGGGGAGGAGGAGCCAAGATGG - Intronic
1092012090 12:5122413-5122435 CTGAGGCGGAGGAGCCAAGATGG - Intergenic
1092282917 12:7110728-7110750 AAGAGGACAGGGAGCCAAGAGGG + Intergenic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1092709005 12:11314740-11314762 GATTGGAGGAGGAGCCAAGATGG + Intergenic
1093986163 12:25536710-25536732 AAGTAGGGGAGGAGCCAAGATGG + Intronic
1094803382 12:34064971-34064993 CATTAGAGGAGGAGCCAAGATGG + Intergenic
1094861400 12:34470176-34470198 AAATGGAGGAGGAGCCAAGATGG - Intergenic
1095591233 12:43906478-43906500 AAGCGGGGGAGGAGCCAAGATGG + Intronic
1095657546 12:44687414-44687436 AAGAGGGGGAGGAGCCAAGATGG - Intronic
1095873587 12:47056715-47056737 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096243549 12:49972292-49972314 CAGAGACGGAGGAGCCAAGAAGG + Intronic
1096433528 12:51568639-51568661 AATCGGAGGAGGAGCCAAGATGG - Intergenic
1096901661 12:54889016-54889038 GAGGGGAGGTGGAGCCAAGATGG - Intergenic
1096922496 12:55102265-55102287 TCTTGGAGGAGGAGCCAAGATGG - Intergenic
1096940848 12:55344246-55344268 TAGAGGGGGAGGAGCCAAGATGG + Intergenic
1097042509 12:56164283-56164305 CAGGTGAGAAGGGGCCAAGAGGG - Exonic
1098372941 12:69779423-69779445 AATGGGAGGAGGAGCCAAGATGG - Intronic
1098444789 12:70555320-70555342 AGGTGGGGAAGGAACCAAGAGGG + Intronic
1098794701 12:74874865-74874887 TGGTGGAGGAGGAGCCAAGATGG + Intergenic
1098922953 12:76319621-76319643 GGGTGGGGGAGGAGCCAAGATGG + Intergenic
1099001145 12:77179406-77179428 AAGCGGGGGAGGAGCCAAGATGG - Intergenic
1099841748 12:87975299-87975321 CCTGGGGGAAGGAGCCAAGATGG - Intergenic
1100270929 12:93023765-93023787 CAGTGGTGAAGGAGAAGAGAAGG - Intergenic
1100750925 12:97697427-97697449 CAGGGGAGGAGGTTCCAAGATGG - Intergenic
1101380382 12:104209072-104209094 CATTGCTGAAGGAGGCAAGAAGG - Intergenic
1101537062 12:105628258-105628280 GAGGGGGGGAGGAGCCAAGATGG + Intergenic
1101874952 12:108591786-108591808 CGGTGGGGACGGAGCCAGGATGG - Exonic
1101928986 12:108996944-108996966 TAGAGGAGGAGGAGCCAAGATGG + Intronic
1102047742 12:109840331-109840353 CACTGGGGAAAGAGCAAAGAAGG - Intergenic
1102309649 12:111835297-111835319 ATGGGGAGGAGGAGCCAAGATGG - Intergenic
1102933672 12:116880335-116880357 CACTCGAGAAGGAGCGAAGTTGG + Intronic
1103424770 12:120823562-120823584 CAGAGGAGAAGGAGAAAATACGG - Intronic
1104556042 12:129800698-129800720 CCAGGGAGGAGGAGCCAAGATGG + Intronic
1105465660 13:20637369-20637391 CAGTTGTGAAGGAGCCATGGCGG + Intronic
1106913329 13:34486276-34486298 AACAGGAGGAGGAGCCAAGATGG - Intergenic
1106991749 13:35428264-35428286 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1107168658 13:37314076-37314098 CCTGGGAGAGGGAGCCAAGATGG + Intergenic
1107971250 13:45645027-45645049 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
1108441321 13:50456256-50456278 CAGTGGACAAGGAGGCTGGAGGG - Intronic
1109270685 13:60252033-60252055 GAGTGAGGGAGGAGCCAAGATGG - Intergenic
1110991190 13:82045346-82045368 TAGGGGGGGAGGAGCCAAGATGG + Intergenic
1111122713 13:83875754-83875776 CAATGGAAAAGGAGGAAAGAAGG - Intergenic
1114003869 14:18289846-18289868 CGGAGGAGGAGGAGCCAAGATGG - Intergenic
1114134370 14:19830211-19830233 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1114330230 14:21629403-21629425 CAGGAGAGAGAGAGCCAAGAGGG + Intergenic
1114401196 14:22412393-22412415 TAGTGGAGGAGGAGCCAGCAAGG - Intergenic
1114533265 14:23408372-23408394 CAAAGGAGGAGGAGCCAGGAGGG - Intergenic
1114751631 14:25210545-25210567 AAAAGGAGGAGGAGCCAAGATGG - Intergenic
1114872933 14:26679356-26679378 GGGTGGGGGAGGAGCCAAGATGG - Intergenic
1115186248 14:30690819-30690841 AAGTGGGCGAGGAGCCAAGATGG - Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115804829 14:37038968-37038990 CATTCTAGAAGGAGCAAAGAGGG - Intronic
1115884536 14:37956441-37956463 CTATGGGGGAGGAGCCAAGACGG - Intronic
1116696670 14:48187079-48187101 CATTGGAGGAGGAGCCAAGATGG + Intergenic
1117577273 14:57112207-57112229 TATAGGAGGAGGAGCCAAGATGG + Intergenic
1117858506 14:60062625-60062647 GACTGGAGAAGGAGGCAAGTAGG - Intronic
1117993698 14:61459119-61459141 CCCTGGAGAAGGCACCAAGAGGG + Intronic
1118229941 14:63938482-63938504 CAGTGGAGAAGGAGCAGAAAGGG + Intronic
1120157871 14:81114162-81114184 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1120524652 14:85563664-85563686 CATTGGAGAAGGGGCCTGGAAGG - Intronic
1122538969 14:102486155-102486177 CAGTGCAGAAGGACCCACCACGG + Intronic
1123577427 15:21685802-21685824 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123614050 15:22128272-22128294 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123790388 15:23714065-23714087 CCATTGAGGAGGAGCCAAGATGG + Intergenic
1124152508 15:27193854-27193876 AAGCGGGGGAGGAGCCAAGATGG - Intronic
1125226867 15:37405458-37405480 CCCTGGGGGAGGAGCCAAGATGG - Intergenic
1127016849 15:54698815-54698837 CGGGAGAGAAGGAGCCAAGATGG + Intergenic
1127157258 15:56140610-56140632 TAGCGGGGAAGGAGCCAAGATGG - Intronic
1127172505 15:56317159-56317181 CAAGGGGGGAGGAGCCAAGATGG - Intronic
1127348422 15:58125728-58125750 TACTGGGGGAGGAGCCAAGATGG + Intronic
1127360395 15:58240136-58240158 CAGTTGAGAAGGAGCCAGAAAGG - Intronic
1127456238 15:59158512-59158534 CAGTGGAGAAGGAGCCGTTGAGG + Intronic
1127471493 15:59294618-59294640 CAGGGGCAAGGGAGCCAAGAAGG - Intronic
1127719487 15:61685857-61685879 GAGTGGAGAAGGAGCTGAGATGG - Intergenic
1128087823 15:64897917-64897939 CTGTGGAGCTGGAGCCAACAGGG - Intronic
1128341779 15:66827447-66827469 ATGTCGAGAAGGAGCCAAGCTGG + Intergenic
1128569877 15:68726277-68726299 CAGTGGACCAGGAAGCAAGAGGG + Exonic
1128857622 15:71032425-71032447 CAGAATAGAAGGAACCAAGAGGG - Intronic
1128974957 15:72145229-72145251 AAGTGAAGAAGGTGCCAAAACGG - Intergenic
1129150402 15:73684586-73684608 CAGGGGAGCAGGAGCCCGGAGGG - Intronic
1129250391 15:74305556-74305578 CAGTGCTTCAGGAGCCAAGAAGG + Intronic
1129604452 15:77018030-77018052 CAGGGGAGATGGAGGCAGGAGGG + Intronic
1129646231 15:77436338-77436360 CAGTGGAGATGTAGCAAAGAGGG - Intronic
1130029360 15:80297736-80297758 CAGTGGAGGATGAGAAAAGAGGG + Intergenic
1130218324 15:81995163-81995185 CGGGGGGGGAGGAGCCAAGATGG + Intergenic
1130818202 15:87463735-87463757 AAGGGGGGGAGGAGCCAAGATGG + Intergenic
1131584135 15:93675396-93675418 TATTGGAGGAGGAGCCAAGATGG + Intergenic
1131843029 15:96458411-96458433 CAGCGGAGAAGGAGTTGAGAGGG - Intergenic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1202986296 15_KI270727v1_random:420047-420069 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1133403439 16:5505200-5505222 TAGAGGAGAAGGGGGCAAGAAGG - Intergenic
1134053803 16:11156589-11156611 CAGTAGAGAGGCAGCCCAGATGG + Intronic
1134767700 16:16775181-16775203 CAGTGGGGGAGGTTCCAAGATGG - Intergenic
1135229637 16:20693711-20693733 AAGTGGAGAAGCAGGCAGGAGGG - Intronic
1135407854 16:22210939-22210961 CAGTGGAGAGGAAGCCAACCAGG + Intronic
1135463314 16:22663845-22663867 GAGAAGAGAAGAAGCCAAGAAGG + Intergenic
1136701313 16:32146234-32146256 CAGTCGAGAAAGAAGCAAGAGGG + Intergenic
1136766349 16:32781230-32781252 CAGTCGAGAAAGAAGCAAGAGGG - Intergenic
1136801749 16:33089148-33089170 CAGTCGAGAAAGAAGCAAGAGGG + Intergenic
1136917432 16:34218855-34218877 TCGGGGGGAAGGAGCCAAGATGG - Intergenic
1137348113 16:47683894-47683916 GATTGGAGGTGGAGCCAAGATGG - Intronic
1138258887 16:55598794-55598816 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
1138502897 16:57459460-57459482 CAGTCAAGAAGTAGTCAAGAGGG + Intronic
1139649688 16:68356073-68356095 CACTGGTGGAGGAGCCAGGAAGG + Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141894305 16:86948752-86948774 CAGTGCAGAGGGAGCAAAGCTGG + Intergenic
1203068737 16_KI270728v1_random:1043476-1043498 CAGTCGAGAAAGAAGCAAGAGGG - Intergenic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143128977 17:4664152-4664174 GAGGGGAGATGGAGGCAAGAGGG + Intergenic
1143173285 17:4942540-4942562 CAGAGGACAAGGAGCCATCATGG - Intronic
1143399893 17:6637303-6637325 CTGTGGAGAAGGAGACACGGTGG - Intronic
1143551306 17:7631983-7632005 AGGTGGAGACTGAGCCAAGATGG - Exonic
1143563897 17:7710046-7710068 CACAGGATAAGAAGCCAAGAGGG - Exonic
1143682502 17:8487864-8487886 CGGTGTAGATGAAGCCAAGATGG + Intronic
1143734303 17:8899676-8899698 AAGTGGAGAAAGAGCTAGGATGG - Intronic
1143769430 17:9158590-9158612 CAGTGGACCAGGAGCCAGAAGGG + Intronic
1144061565 17:11587396-11587418 CAGTTGAGAAGGACTCAAGATGG - Intergenic
1145121892 17:20267641-20267663 CACGTGAGAAGGAGCCAAGAAGG + Intronic
1146541462 17:33699353-33699375 TAGTGGGGAAGGAGACATGAGGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146752450 17:35393946-35393968 AACGGGAGGAGGAGCCAAGACGG + Intergenic
1147537896 17:41332854-41332876 CAGTGGGGAGGGGGCCGAGAAGG - Intergenic
1147687249 17:42293880-42293902 CTGGGGAGAAGGAACCAAGTGGG + Intronic
1148216717 17:45837392-45837414 CAGGGGTGGAGGAGCCGAGAGGG + Intergenic
1148687662 17:49509620-49509642 CAGTGGAGAAGGGGCCCATGAGG - Intronic
1148765725 17:50037308-50037330 CAGGGGAGAAGACTCCAAGAGGG + Intergenic
1148783424 17:50134038-50134060 CAGGGGACAAGAAGCCAAAACGG + Exonic
1148953273 17:51333079-51333101 CAGGGGCGGAGGAGCCAAGATGG - Intergenic
1149323014 17:55501712-55501734 CATTCGGGGAGGAGCCAAGATGG + Intergenic
1149368743 17:55971633-55971655 AAGGGTAGAAGGAGCCTAGAAGG - Intergenic
1149453889 17:56771710-56771732 CACTGGAGAGGGAGGCAGGAGGG + Intergenic
1150255587 17:63741770-63741792 CTGAGGAGGCGGAGCCAAGACGG - Exonic
1150595701 17:66602577-66602599 TTTTGGAGGAGGAGCCAAGATGG - Intronic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1151068991 17:71186668-71186690 GAGTGGGGAAGGAGTCAAAAGGG + Intergenic
1151609199 17:75160685-75160707 CAGTTAAAAAGGACCCAAGAGGG - Intronic
1152233311 17:79125648-79125670 GAGAGGAGAGGGAGCCAGGAAGG - Intronic
1152242595 17:79168099-79168121 CAGAGGCTAAGGAGCCCAGAGGG + Intronic
1152617418 17:81344414-81344436 CGGAGGCGAAGGAGGCAAGATGG - Intergenic
1153006911 18:505066-505088 GAGTGGAGAAGGTGCCAAGGTGG - Intergenic
1153164535 18:2247164-2247186 CTGAGGGGGAGGAGCCAAGATGG + Intergenic
1153221522 18:2866325-2866347 TAGAGGGGAAGGAGCCAAGATGG - Intronic
1153429828 18:5004133-5004155 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
1153679032 18:7483073-7483095 CAGTGGAGACGGAGCTTAGGAGG - Intergenic
1154009086 18:10560183-10560205 CTGTGGAGAAGCAGCCACAAGGG + Intergenic
1156235995 18:35205776-35205798 AATTGGGGGAGGAGCCAAGATGG + Intergenic
1156292464 18:35760305-35760327 AAGGGGGGGAGGAGCCAAGATGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157158236 18:45288394-45288416 CAGTGGGGCAGGAGCAACGATGG + Intronic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1157260489 18:46172415-46172437 AACAGGAGAAGGACCCAAGATGG + Intergenic
1157293097 18:46423892-46423914 CAGTGAAGAAGGAGGAACGAGGG - Intronic
1157701373 18:49763132-49763154 CAGAGGGGAGGGAGCCAGGAAGG - Intergenic
1158399879 18:57112433-57112455 CAGTGTAGAAGGAGCAATGGTGG + Intergenic
1158994662 18:62906289-62906311 TATTGGGGGAGGAGCCAAGATGG + Intronic
1159631389 18:70752563-70752585 CACCGGGGGAGGAGCCAAGATGG - Intergenic
1162641079 19:12010797-12010819 AAAAGGAGGAGGAGCCAAGACGG - Intergenic
1164250127 19:23468686-23468708 AAGAGGAGAAGGAGGGAAGAAGG - Intergenic
1164552803 19:29225776-29225798 TGGTGGGGGAGGAGCCAAGATGG + Intergenic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1164918684 19:32072320-32072342 CAGTGGAGAAGGCCCCGTGACGG - Intergenic
1165304394 19:34994804-34994826 CAGAGGAGGAGGACCCAATAAGG + Intronic
1165447946 19:35866942-35866964 CAATGGAAATGCAGCCAAGATGG + Exonic
1165703226 19:37954490-37954512 CAGTGGGGAAGGAGACAGGCTGG + Intronic
1165890776 19:39111060-39111082 AGGTGGGGAAGGAGCCAAGTGGG + Exonic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166489692 19:43248087-43248109 AACTGGGGAAGGAGCCAAGATGG - Intronic
1167253871 19:48415681-48415703 CAGAGGAGGAGGGGCCAGGAGGG + Intronic
1202632545 1_KI270706v1_random:13975-13997 AATGGGAGGAGGAGCCAAGATGG - Intergenic
925398092 2:3551189-3551211 CAGTGGCGAAGGGGCAAAGATGG + Intronic
925796845 2:7554825-7554847 CAGTGGAGAAGCTGCCAAGAGGG + Intergenic
926230751 2:11002118-11002140 CTGGGGAGGAGGAGCCAAGATGG - Intergenic
926793554 2:16599740-16599762 AGTTGGAGGAGGAGCCAAGATGG - Intronic
928383665 2:30845650-30845672 CAGTGGAGCAGGAGACTAGCAGG - Intergenic
928399701 2:30969035-30969057 CAGAGGGGAAGGAGCCAGCATGG + Intronic
928883013 2:36118519-36118541 TGGGGGAGGAGGAGCCAAGATGG - Intergenic
929118470 2:38464720-38464742 CAGTGGTGTAGGTGCCAACATGG + Intergenic
929274908 2:40014601-40014623 ACATGGAGGAGGAGCCAAGATGG - Intergenic
930251441 2:49038892-49038914 CAATAGAGAAGGAGAAAAGAAGG + Intronic
930489145 2:52045534-52045556 AACAGGAGGAGGAGCCAAGATGG - Intergenic
930911750 2:56637374-56637396 GGGTGGGGGAGGAGCCAAGATGG - Intergenic
931130073 2:59326303-59326325 TAGATGGGAAGGAGCCAAGATGG + Intergenic
931249382 2:60516487-60516509 CACTGGGAGAGGAGCCAAGAGGG + Intronic
931320735 2:61172701-61172723 GAGTGGTGAAGGAGACAACAAGG + Intergenic
931498216 2:62835475-62835497 AAGCGGGGGAGGAGCCAAGATGG + Intronic
932077660 2:68680057-68680079 AAATTGAGGAGGAGCCAAGATGG - Intronic
932483372 2:72063972-72063994 TACTGGGGGAGGAGCCAAGATGG + Intergenic
933519001 2:83347470-83347492 CAGGAGGGGAGGAGCCAAGATGG + Intergenic
933650540 2:84846769-84846791 CCTTGGAGAAAGACCCAAGACGG + Intronic
934037387 2:88099817-88099839 CAGAGGAAAAGGAGCCAAAGAGG - Intronic
934531370 2:95091304-95091326 AAGGTGAGAAGGAGCCAAGGGGG - Intronic
935489520 2:103699006-103699028 AAATGGGGAAGGGGCCAAGATGG - Intergenic
935739100 2:106130889-106130911 CTGGGGGGGAGGAGCCAAGATGG + Intronic
935742318 2:106160436-106160458 CGGTAGAGAAGGAGCCCTGAAGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936872967 2:117156031-117156053 TTGAGGAGGAGGAGCCAAGATGG + Intergenic
938149004 2:128864998-128865020 TAGCGGAGGAGGAGCCAAGATGG - Intergenic
938229460 2:129646001-129646023 CTGTGGACAAGGAGCCATGCTGG - Intergenic
938375227 2:130800519-130800541 CAGGGTGGGAGGAGCCAAGAGGG + Intergenic
938379258 2:130827412-130827434 CAGTGGAGGAGGAGCCACGAAGG - Intergenic
938405046 2:131027861-131027883 ACGTGGAGAAGGAGCCCAGTGGG - Intronic
938659486 2:133471020-133471042 CAGGGGGGGAGGAGCCAAGATGG - Intronic
939051738 2:137315516-137315538 TAGTGGGGGAGGAGCCAAGATGG - Intronic
939241168 2:139561534-139561556 GATTGGAGATGGAGCAAAGAGGG + Intergenic
939626586 2:144484675-144484697 CAGTGGAGGAGAAGACAGGAAGG - Intronic
939890126 2:147727000-147727022 CACTAGGGGAGGAGCCAAGATGG + Intergenic
940465827 2:154025298-154025320 CATGGGGGGAGGAGCCAAGATGG - Intronic
940573729 2:155472626-155472648 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
940632219 2:156254514-156254536 TGGTTGAGGAGGAGCCAAGATGG + Intergenic
940919944 2:159295117-159295139 TATAGGAGGAGGAGCCAAGATGG - Intergenic
941100115 2:161286192-161286214 AAGTGGAGGAGGTTCCAAGATGG + Intergenic
941882213 2:170492658-170492680 CCATGGAGAAGGAGTAAAGAGGG - Intronic
942759898 2:179385753-179385775 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
942879346 2:180839672-180839694 TATTAGAGGAGGAGCCAAGATGG - Intergenic
943274354 2:185847741-185847763 GAGTTCAGGAGGAGCCAAGATGG - Intergenic
943309929 2:186312989-186313011 CAGAGGGGGCGGAGCCAAGATGG + Intergenic
943441672 2:187933857-187933879 CAGTGGAGAAGCTGCCCTGATGG - Intergenic
943566862 2:189526239-189526261 CCCTGGGGGAGGAGCCAAGATGG - Intergenic
943934913 2:193903871-193903893 CCTTGGAGGTGGAGCCAAGATGG + Intergenic
945429927 2:209752190-209752212 TGGTGGGGGAGGAGCCAAGATGG - Intergenic
945550768 2:211219317-211219339 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
946530393 2:220564186-220564208 AAGTGGAGACGGAGACGAGAAGG - Intergenic
947353982 2:229273110-229273132 AACTGGAGAAGGAGCTGAGAAGG - Intergenic
948436266 2:237956232-237956254 GAGTGGGGGCGGAGCCAAGAAGG + Intergenic
948459967 2:238124299-238124321 CAGTGGGGGAGGTGCCCAGAGGG + Intronic
948846394 2:240684678-240684700 CTGTGGAGAATGAGCTCAGACGG + Intergenic
948847468 2:240690055-240690077 CTGTGGAGAATGAGCTCAGACGG - Intergenic
948885710 2:240882977-240882999 CAGTGAAGAAGGCGCTCAGAGGG - Intergenic
1169589290 20:7122182-7122204 TTGTCGAGGAGGAGCCAAGATGG - Intergenic
1170327445 20:15172197-15172219 CAGTGGAGGAAGAGGCAAAAAGG + Intronic
1170598425 20:17822691-17822713 CAGTGGAGACGGGCCCAAGAGGG - Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171023674 20:21609542-21609564 CAGAGGAGAAGGATCAAGGAGGG + Intergenic
1171294349 20:24004601-24004623 CAGTGGATAAGGAGATAACAGGG - Intergenic
1171913053 20:30985452-30985474 ATGGGGAGGAGGAGCCAAGATGG + Intergenic
1171986165 20:31662712-31662734 TAGTAGAGAAGGAGGTAAGAAGG - Intergenic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1173381604 20:42549457-42549479 CAGAGAAGAAGGAGATAAGAGGG + Intronic
1173774648 20:45693963-45693985 AACAGGAGGAGGAGCCAAGATGG - Intronic
1174161746 20:48555959-48555981 CAGAGGAGAAGGAACCAAAATGG - Intergenic
1175337288 20:58204942-58204964 CAGGGGAGATGGAGCCGAGGGGG - Intergenic
1175466713 20:59194403-59194425 CAGTGAGGAAGGAGCCAGGCTGG - Exonic
1175830671 20:61963868-61963890 CTGTGAAGAAATAGCCAAGATGG + Intronic
1176009103 20:62882322-62882344 CAGTGGAGAGTTAGACAAGATGG - Exonic
1176087643 20:63305321-63305343 GTGGGGAGGAGGAGCCAAGAGGG + Intronic
1176186406 20:63782321-63782343 CAGCAGAGAAGGAGGCAGGAGGG + Intronic
1176192071 20:63816282-63816304 GAGCAGAGATGGAGCCAAGAGGG - Intronic
1176644759 21:9339855-9339877 AATGGGAGGAGGAGCCAAGATGG - Intergenic
1176757876 21:10739640-10739662 CACTGGAGGAGGAGCCAAGATGG + Intergenic
1176941070 21:14927079-14927101 GAGAGGGGGAGGAGCCAAGATGG + Intergenic
1177137983 21:17327479-17327501 CAATGGGGGAGGAGCCAAGATGG + Intergenic
1177937319 21:27365807-27365829 TAGTGGAGATGGAGCCATGCAGG - Intergenic
1178770551 21:35499773-35499795 GAGGGGGGGAGGAGCCAAGATGG - Intronic
1179031861 21:37727550-37727572 ATGTTGAGAAGGAGCCAAAAGGG + Intronic
1179292778 21:40033158-40033180 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1179725134 21:43337766-43337788 CAGAGGTGAAGGAGCCTAGAGGG - Intergenic
1180120598 21:45745067-45745089 CAGTGGAGAAGGTGCCCAGAGGG + Intronic
1180126083 21:45791098-45791120 CAGTGGCGAAGGTGCAGAGATGG + Intronic
1180368192 22:11959378-11959400 AATGGGAGGAGGAGCCAAGATGG + Intergenic
1180377902 22:12111953-12111975 AATGGGAGGAGGAGCCAAGATGG - Intergenic
1180419611 22:12801327-12801349 AATGGGAGGAGGAGCCAAGATGG + Intergenic
1180428382 22:15220649-15220671 TGGAGGAGGAGGAGCCAAGATGG - Intergenic
1182585384 22:31341743-31341765 CAGAGTAGGAGGAGCCCAGAGGG - Intronic
1182619835 22:31613039-31613061 GACTAGAGAGGGAGCCAAGAGGG + Intronic
1182798153 22:33006467-33006489 CACTGGAGAGGGAGCTAAAAAGG + Exonic
1183442804 22:37832819-37832841 CAGTGGAGCAGGTGCCAACTGGG + Intronic
1184772769 22:46607605-46607627 CAGCGGAGATGGAGCCAAGCAGG - Intronic
949425297 3:3909459-3909481 CACTTGAGGAGGAGCCAAGATGG - Intronic
949602482 3:5615249-5615271 AAAGGGAGAAGAAGCCAAGAAGG - Intergenic
949737849 3:7194971-7194993 CAGCGAATAAGGAACCAAGAAGG - Intronic
949873878 3:8611521-8611543 AAGTGGGGGAGCAGCCAAGATGG + Intergenic
949994558 3:9606255-9606277 GGGAGGAGAAGAAGCCAAGAGGG - Intergenic
950314315 3:11987053-11987075 TAGAGGAGCAGGTGCCAAGATGG - Intergenic
950597286 3:13995843-13995865 CAGGAGGGGAGGAGCCAAGATGG - Intronic
950916081 3:16646629-16646651 CCGTGGGGATGGGGCCAAGAGGG + Intronic
951198804 3:19855045-19855067 CATCGGGGGAGGAGCCAAGATGG + Intergenic
951219158 3:20051352-20051374 CAGGGGAGAAGGAGCTATGCAGG - Intronic
951321984 3:21255737-21255759 TTGTGGGGGAGGAGCCAAGATGG - Intergenic
951330677 3:21364850-21364872 ATGTGGGGGAGGAGCCAAGACGG + Intergenic
951489577 3:23254712-23254734 CTGGGGAGGAGTAGCCAAGAAGG + Intronic
951572958 3:24084556-24084578 CATTGTCGGAGGAGCCAAGATGG - Intergenic
951783506 3:26390749-26390771 CAGTGGGGGAGGAGCCAAGATGG - Intergenic
951818503 3:26783093-26783115 CACAGGGGGAGGAGCCAAGATGG + Intergenic
952503907 3:33989885-33989907 GAGTGGGGACGGGGCCAAGATGG - Intergenic
952537585 3:34328302-34328324 CATTGGAGAAAGTGCAAAGAGGG - Intergenic
952545943 3:34419154-34419176 TATCGGAGGAGGAGCCAAGATGG - Intergenic
952547287 3:34433867-34433889 CCTTGGGGGAGGAGCCAAGATGG - Intergenic
952659272 3:35824674-35824696 TAATGGGGGAGGAGCCAAGATGG - Intergenic
952962976 3:38604362-38604384 CAAGGGAGAAGGAGGCAGGAAGG + Intronic
953237849 3:41121662-41121684 CAGGAGGGAAGGAGCCAATAAGG + Intergenic
953360053 3:42288059-42288081 AATTGGAGGAGGAGCCAAGATGG - Intergenic
953894864 3:46789120-46789142 TGCTGGAGGAGGAGCCAAGATGG - Intronic
954185115 3:48911045-48911067 CACTGGGGAAGGAGCGTAGATGG + Intergenic
954497563 3:50979154-50979176 CACTGGGGGAGGAGCCAAGATGG - Intronic
955030172 3:55209128-55209150 AAATGGAGGTGGAGCCAAGATGG + Intergenic
955169154 3:56546287-56546309 CAGTGGGGAAGGAGTAAACAAGG + Intergenic
955207632 3:56911017-56911039 CAGTGGAGACGTAGCCATCAAGG - Intronic
955524306 3:59804996-59805018 CAGGGGAGAGGGAGCTAAGGCGG + Intronic
955854188 3:63255608-63255630 GACTTGAGGAGGAGCCAAGATGG + Intronic
956014499 3:64867385-64867407 TAGTGGAGAAGGAAAGAAGAGGG + Intergenic
956225075 3:66948269-66948291 CAGAGGAGCAGGGGCCAAGAAGG - Intergenic
956349660 3:68320848-68320870 CAGGGGAGAAGGAGGTAAGCAGG - Intronic
956866549 3:73374597-73374619 AACTGGGGGAGGAGCCAAGATGG - Intergenic
957215612 3:77316898-77316920 TAGTGGAGAAGCAGGCATGAGGG + Intronic
957601163 3:82337496-82337518 CTGCGGGGGAGGAGCCAAGATGG + Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957806252 3:85153068-85153090 CTGCGGGGGAGGAGCCAAGATGG + Intronic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
958155147 3:89747610-89747632 GCGGGGAGGAGGAGCCAAGATGG + Intergenic
958704761 3:97641424-97641446 GGGTGGGGGAGGAGCCAAGATGG + Intronic
959169728 3:102830374-102830396 CAGTTGATATGGAGCCCAGAGGG + Intergenic
959617931 3:108369323-108369345 CACGGGGGGAGGAGCCAAGATGG + Intronic
959721329 3:109492951-109492973 CAGTGGAGAAGTAGATGAGATGG + Intergenic
960054214 3:113265083-113265105 GGGTGCAGCAGGAGCCAAGAGGG + Intronic
960153729 3:114276888-114276910 CGGAGGGGGAGGAGCCAAGATGG + Intergenic
961291437 3:125849807-125849829 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
961331936 3:126147617-126147639 CAGTGGGGCAGGAGTCAGGAGGG + Intronic
962161551 3:133005644-133005666 CATGGGGGGAGGAGCCAAGATGG - Intergenic
962208231 3:133453490-133453512 CAGTAGAGGAGAAGCAAAGAAGG + Intronic
962836820 3:139196748-139196770 CAGCCGAGGTGGAGCCAAGACGG - Intronic
963119341 3:141763135-141763157 ATCTGGAGGAGGAGCCAAGATGG - Intergenic
963175142 3:142290200-142290222 CCCTGGTGGAGGAGCCAAGATGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
965100413 3:164291522-164291544 TCCTGGAGGAGGAGCCAAGATGG + Intergenic
965395416 3:168155417-168155439 AAGTGGAGGAGGAGCCCACATGG - Intergenic
965451119 3:168839969-168839991 TAGTGGGGAAGGAGCCAGGGAGG - Intergenic
965628795 3:170709333-170709355 TAGAGGGGAAGGAGCCCAGATGG - Intronic
966302523 3:178495381-178495403 TAGTGGAGATGAAGCCAAGTGGG - Intronic
967285193 3:187862477-187862499 CATGGGGGGAGGAGCCAAGATGG + Intergenic
967845678 3:194040847-194040869 ATGTGGAGAAGCAGCCAAGAGGG + Intergenic
1202742132 3_GL000221v1_random:65213-65235 AATGGGAGGAGGAGCCAAGATGG + Intergenic
968698605 4:2044262-2044284 CAGTGGTGCAGGAGCCTGGAGGG - Intergenic
969005858 4:4019685-4019707 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969726220 4:8920055-8920077 CAGGGGAGAAGAAGCCATGGAGG + Intergenic
969747034 4:9080575-9080597 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969807091 4:9617605-9617627 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
970219816 4:13798974-13798996 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
972832305 4:42828405-42828427 CAGTGGTCAAAGAGCCCAGATGG - Intergenic
972995903 4:44879455-44879477 CAGTCAGGGAGGAGCCAAGATGG + Intergenic
973362171 4:49175946-49175968 AATGGGAGGAGGAGCCAAGATGG - Intergenic
973398925 4:49620914-49620936 AATGGGAGGAGGAGCCAAGATGG + Intergenic
973681850 4:53328728-53328750 TATTGGGGGAGGAGCCAAGATGG + Intronic
973736522 4:53877113-53877135 TACTGGGGGAGGAGCCAAGATGG + Intronic
974123858 4:57671696-57671718 CTGTGGAGAAGGAGGCATGTAGG + Intergenic
974299101 4:60041560-60041582 GTGTGGAAAAGGAGCCAAGCAGG + Intergenic
975165608 4:71175203-71175225 AAGTGGGGGTGGAGCCAAGATGG + Intergenic
975280389 4:72555468-72555490 CTGTGGATAAGTTGCCAAGAAGG - Intronic
975467363 4:74723569-74723591 AAGCGGAGGAGGAGCCAAGATGG - Intergenic
975518896 4:75276589-75276611 TGGTGGAGGAGGAGCCAAGATGG - Intergenic
976014181 4:80530619-80530641 TAGAGGGGAAGGAGACAAGAAGG + Intronic
976332876 4:83852121-83852143 CAGAGGAGGAGAAGACAAGAAGG - Intergenic
977264872 4:94841767-94841789 TACTGGGGGAGGAGCCAAGATGG - Intronic
977505855 4:97903595-97903617 AAGAGGGGAAGGAGCCAAGATGG + Intronic
977516278 4:98024164-98024186 AAGTTGGTAAGGAGCCAAGATGG - Intronic
978060228 4:104327613-104327635 CAGTATAGGTGGAGCCAAGATGG - Intergenic
978736120 4:112086460-112086482 TCTTGGAGGAGGAGCCAAGATGG + Intergenic
979216792 4:118174867-118174889 CAGTGGAGAGGCAGGCAAGAAGG - Intronic
979561865 4:122110089-122110111 GGGCGGAGGAGGAGCCAAGATGG + Intergenic
980010435 4:127588927-127588949 TTGTGGGGGAGGAGCCAAGATGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980448755 4:132944405-132944427 CAGAGGAGGAGGAGCCAAGATGG + Intergenic
980761972 4:137246462-137246484 AAGTGGACAATGAGGCAAGATGG + Intergenic
980899076 4:138887421-138887443 TAGAGGGGGAGGAGCCAAGATGG - Intergenic
981618007 4:146663283-146663305 CATAGGAGGAGGAGCCAAGATGG + Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
982203249 4:152978019-152978041 CAGTGGAGTATGAGCCTTGAGGG + Exonic
983147953 4:164241610-164241632 AAATGGGGGAGGAGCCAAGATGG + Intronic
983446317 4:167857878-167857900 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
983598864 4:169500530-169500552 TGTTGGAGGAGGAGCCAAGATGG - Intronic
983934003 4:173486360-173486382 CAGTGGTGAAGGATGCAAAATGG - Intergenic
984063382 4:175019736-175019758 TTGTTGAGGAGGAGCCAAGATGG + Intergenic
984315948 4:178131440-178131462 AAGTGGGAAAGGAACCAAGATGG + Intergenic
984669566 4:182466801-182466823 CAGAGGAAAAGGATACAAGAAGG + Intronic
985235005 4:187862902-187862924 AAGGGGGGGAGGAGCCAAGATGG - Intergenic
1202759516 4_GL000008v2_random:97414-97436 AATGGGAGGAGGAGCCAAGATGG - Intergenic
986090776 5:4502354-4502376 GACTGAAGGAGGAGCCAAGATGG - Intergenic
986381748 5:7193766-7193788 AAGGGGGGGAGGAGCCAAGATGG + Intergenic
986978165 5:13416494-13416516 CCGAGGAGGAGGAGCCAAGATGG + Intergenic
987482020 5:18471812-18471834 CATCAGAGGAGGAGCCAAGATGG + Intergenic
987561652 5:19531086-19531108 TATTGGAGGTGGAGCCAAGATGG - Intronic
988648434 5:33122367-33122389 AACTGGAGGAGGAGCCAAGATGG + Intergenic
988984930 5:36608435-36608457 CAATGGAGAAGAGCCCAAGATGG + Exonic
989183447 5:38600668-38600690 GAGAGGAAAAGGAGCCAGGAAGG - Intronic
989276974 5:39600586-39600608 CAGTGGAGAAGCAGGCACGGTGG + Intergenic
989429757 5:41339039-41339061 CACTGCAGAAGAAGCCATGAAGG - Intronic
989550864 5:42734711-42734733 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
989656378 5:43749328-43749350 CTATGGGGGAGGAGCCAAGATGG - Intergenic
989793980 5:45444890-45444912 CATTAGGGGAGGAGCCAAGATGG + Intronic
989798064 5:45499597-45499619 CACAGGGGGAGGAGCCAAGATGG - Intronic
989809652 5:45658437-45658459 CAGAGGGGGAGGAGCCAAGATGG + Intronic
990179117 5:53141063-53141085 CAGGGGCGGAGGAGCCAAGATGG + Intergenic
990367036 5:55081484-55081506 CAGCGGGGGTGGAGCCAAGATGG - Intergenic
991304633 5:65164014-65164036 CAGAGGGGGAGGAGCCAAGATGG + Intronic
991545726 5:67780004-67780026 ACGTGGAGGTGGAGCCAAGATGG + Intergenic
992140359 5:73790484-73790506 CTGGGGAGAAGAAACCAAGATGG - Intronic
992192237 5:74304557-74304579 CAGTGGAGAAAGAGGAAAGGAGG + Intergenic
992275048 5:75106801-75106823 CACTGGAGAAGAAGGCAAAATGG + Intronic
992328917 5:75695695-75695717 AAGTGGGGGAGGAGCCAAGATGG + Intronic
992687103 5:79209710-79209732 GGGTGGAGAAGGAGCTCAGAGGG + Intronic
993006668 5:82435405-82435427 CACAGAAGGAGGAGCCAAGATGG - Intergenic
993042727 5:82834057-82834079 CAGTGGGGAAGGAGGCAGGGTGG + Intergenic
993790303 5:92199477-92199499 AACAGGAGGAGGAGCCAAGATGG - Intergenic
994618072 5:102131353-102131375 CAGAGAGGGAGGAGCCAAGATGG + Intergenic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
994806391 5:104452388-104452410 CCCCGGGGAAGGAGCCAAGATGG - Intergenic
994882822 5:105519256-105519278 CATGGGAGGAGGAGCCAAGATGG - Intergenic
995532188 5:113102755-113102777 CAGTGGATAATGAAACAAGAGGG + Intronic
996091865 5:119359187-119359209 CAGAAAAGAAGGAGCCAGGAAGG - Intronic
996348775 5:122515621-122515643 CACTGGGGGAGGAGCCAAGATGG - Intergenic
997134717 5:131312949-131312971 AAAGGGAGGAGGAGCCAAGATGG - Intronic
997440361 5:133904874-133904896 AGGTGGACCAGGAGCCAAGAAGG + Intergenic
997574990 5:134967878-134967900 CAGCAGAGAAGGGGCCACGAAGG - Exonic
998093226 5:139382893-139382915 CACAGGAGAGGGGGCCAAGAGGG + Intronic
998555880 5:143123302-143123324 CAGTGAAAAAGGAGTCAAGATGG - Intronic
998755886 5:145379192-145379214 CACTGGGGAAGGGGCCAAGGAGG + Intergenic
999058716 5:148610184-148610206 AGGTGGTGGAGGAGCCAAGATGG + Intronic
999506856 5:152207297-152207319 GGGGGGAGGAGGAGCCAAGATGG + Intergenic
999548723 5:152659880-152659902 TATTGGGGGAGGAGCCAAGATGG - Intergenic
999606797 5:153325323-153325345 CCGGGGGGAAGGAGCCAAGATGG + Intergenic
999817202 5:155189117-155189139 CAGTGGAACACAAGCCAAGATGG + Intergenic
1001245262 5:170101349-170101371 CAGTGGAGCAGCAGCCAGGCTGG + Intergenic
1001514078 5:172342809-172342831 AATTGCAGAAGGAGCAAAGATGG + Intronic
1001662829 5:173408810-173408832 AAGGGGAGGAGGAGCCAAGATGG - Intergenic
1002129898 5:177074335-177074357 CAGTTGAGAAGTTGCCAAGTGGG + Intronic
1002166346 5:177349877-177349899 CAGATGAGAAGGAACCAAGCAGG + Intronic
1003010646 6:2423785-2423807 TTGTGGAGGAGGAGCCAAGATGG - Intergenic
1003226504 6:4210875-4210897 CAGTGGAGAGTGAGCCAAGGTGG - Intergenic
1003651740 6:7967189-7967211 CAGAGGAAAAGGGGCCAAAAGGG + Intronic
1004954840 6:20717884-20717906 CAGTAGAGAAGGAGAAAGGATGG + Intronic
1005101933 6:22180856-22180878 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
1005239110 6:23804044-23804066 CCCTGGGGGAGGAGCCAAGATGG + Intergenic
1005254553 6:23986775-23986797 CTGTGGACACGGAGCCATGAAGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005656424 6:27943282-27943304 CCAAGGAGGAGGAGCCAAGATGG + Intergenic
1005904318 6:30247879-30247901 CAGCGAGGAAGGAGCCAAGATGG + Intergenic
1006022650 6:31126518-31126540 CATTGGACCAGGAGCCAAGCAGG - Intronic
1006104837 6:31710329-31710351 CTGGGGAGAAGGAGCCATCAGGG - Intronic
1006173259 6:32107590-32107612 CTGTGGGGAGGGTGCCAAGAGGG - Intronic
1006977874 6:38120624-38120646 CAGTGATTAAGAAGCCAAGAAGG - Intronic
1007155215 6:39736402-39736424 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
1007288347 6:40764630-40764652 CAGTCTAGAAGGAGCTATGATGG - Intergenic
1007701117 6:43767188-43767210 CAGTTCAGAAGGAGCCAAGGAGG - Intergenic
1007769498 6:44181211-44181233 CAGCAGAGAAGGAGTGAAGAAGG - Intronic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1008915858 6:56785850-56785872 AAGAGGGGGAGGAGCCAAGATGG - Intronic
1008977526 6:57445522-57445544 CAGTGGCAAAGGAACAAAGATGG - Intronic
1009546662 6:65029675-65029697 AAGAGGAGAAGGAGCCAAGATGG + Intronic
1009985499 6:70777336-70777358 AAATGCAGGAGGAGCCAAGATGG - Intronic
1010173024 6:72994668-72994690 CATGGGAGGAGGAGCCAAGATGG - Intronic
1010856522 6:80847736-80847758 CAAGGGGGGAGGAGCCAAGATGG + Intergenic
1011066595 6:83333949-83333971 CAGGGGGGGAGGAGCCAAGATGG + Intronic
1011107992 6:83803752-83803774 CTTAGGAGGAGGAGCCAAGATGG - Intergenic
1011315610 6:86027497-86027519 TTGGGGGGAAGGAGCCAAGATGG - Intergenic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012434812 6:99204278-99204300 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
1012969684 6:105716119-105716141 TGTTGGAGGAGGAGCCAAGATGG + Intergenic
1013356609 6:109350900-109350922 CAGTGGAGAAGCAGGTAAGCTGG - Intergenic
1013397515 6:109757070-109757092 GAGAGGGGGAGGAGCCAAGATGG - Intronic
1013792410 6:113852675-113852697 CCGTAGAAAAGGAGCCAAGATGG - Intergenic
1014025222 6:116638693-116638715 TGGAGGAGGAGGAGCCAAGATGG + Intronic
1014063756 6:117102128-117102150 CAAGGGAGGAGGAGCCAAGATGG + Intergenic
1014070995 6:117181812-117181834 CAGTCAGGGAGGAGCCAAGATGG + Intergenic
1014120611 6:117721291-117721313 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1015870220 6:137768793-137768815 CACAGGATAAGAAGCCAAGAAGG - Intergenic
1016213249 6:141566102-141566124 AACTGGAGGAGGAGCCAAGATGG + Intergenic
1018234093 6:161705853-161705875 CAATGGAGTAGAAGCTAAGAAGG - Intronic
1018653137 6:166007824-166007846 CAGCAAAGAAGGAGCCAGGAAGG + Intergenic
1019675550 7:2309891-2309913 CAGGGGTGAAGGAGCCCCGAGGG + Intronic
1020112593 7:5455961-5455983 CACTGGGGAAGGAGCACAGAGGG - Intronic
1020326418 7:6977990-6978012 TAGCGGAGGTGGAGCCAAGATGG - Intergenic
1020454039 7:8351720-8351742 GGGTGGGGGAGGAGCCAAGATGG + Intergenic
1020487042 7:8732350-8732372 CGAAGGCGAAGGAGCCAAGATGG - Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021047344 7:15940226-15940248 AATTGGGGGAGGAGCCAAGATGG + Intergenic
1021797224 7:24268461-24268483 GAGTGGAGAAAGAGGCAAGAAGG - Intergenic
1021947650 7:25743829-25743851 TCCTGGAGGAGGAGCCAAGATGG + Intergenic
1022672000 7:32464524-32464546 CACGAGAGGAGGAGCCAAGATGG + Intergenic
1022764092 7:33390736-33390758 CAGATGATAAGGAACCAAGATGG - Intronic
1022843902 7:34191103-34191125 CCCTGGAGATGGATCCAAGAGGG + Intergenic
1024434492 7:49334281-49334303 CAGAAGAGAAAGGGCCAAGAAGG - Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1025911519 7:65832506-65832528 CAGTGGAGCAGAAGGAAAGAGGG + Intergenic
1025967971 7:66292866-66292888 TGGGGGAGGAGGAGCCAAGATGG - Intronic
1026417436 7:70197325-70197347 GGATGGAGGAGGAGCCAAGATGG + Intronic
1028734802 7:94196683-94196705 CACTGGAGAATCAGTCAAGAAGG + Intergenic
1028960243 7:96740474-96740496 AAGGGGAGAAGGAGGAAAGAAGG - Intergenic
1029299754 7:99571063-99571085 CAGGGGATAAGAGGCCAAGAAGG - Intronic
1029612709 7:101635836-101635858 CAATGGAGAGTGAGGCAAGAGGG - Intergenic
1030063350 7:105640451-105640473 CAGGGGTGAAGGACCCAAGATGG - Intronic
1030185982 7:106762331-106762353 CAGTGAACTAGGGGCCAAGAAGG + Intergenic
1030572943 7:111249528-111249550 AAGAGGGGGAGGAGCCAAGATGG - Intronic
1030792101 7:113742897-113742919 TTTCGGAGAAGGAGCCAAGATGG + Intergenic
1031614365 7:123863981-123864003 CAGTGAAGAAGGTGGCAGGAGGG - Intronic
1032504544 7:132425494-132425516 AAGGGGAGGAGGAGCCAGGAGGG - Intronic
1032768390 7:135023186-135023208 CAATGAAGGAGGAGACAAGATGG + Intronic
1033767914 7:144514845-144514867 CAGAGCAGAAACAGCCAAGAGGG - Intronic
1034038348 7:147848605-147848627 GAAGGGAGGAGGAGCCAAGATGG - Intronic
1034425236 7:151010519-151010541 CAGTGGGGGAGGGGTCAAGAAGG + Intronic
1035122212 7:156578396-156578418 CAGAGGAGGAGGAGCAAAGCAGG - Intergenic
1035788965 8:2286322-2286344 CACTGGCGTAGAAGCCAAGAGGG + Intergenic
1035803840 8:2435383-2435405 CACTGGCGTAGAAGCCAAGAGGG - Intergenic
1037506828 8:19538933-19538955 CAGAAGAGAAGGAGCCAGGAGGG - Intronic
1037546625 8:19930157-19930179 CAATAGGGGAGGAGCCAAGATGG + Intronic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038428960 8:27484601-27484623 CAGGGGAGAATGGGCCAAGAAGG + Intergenic
1038438513 8:27555417-27555439 CATCGGGGGAGGAGCCAAGATGG - Intergenic
1038483259 8:27915987-27916009 CAGAGGAGAAGGAGCCCAGGAGG - Intronic
1039003520 8:33008277-33008299 CAGGGCAGAAGGATCCATGAAGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039509271 8:38077841-38077863 CACTGGGGAAGCAGCCCAGATGG - Intergenic
1039586917 8:38714549-38714571 GAGTGAAGAAGGAGCCTTGAGGG - Intergenic
1039698348 8:39936717-39936739 CAGTGGATTAGCATCCAAGATGG + Intronic
1040591817 8:48799912-48799934 CATGGGGGGAGGAGCCAAGATGG - Intergenic
1040697717 8:50022343-50022365 GAGTGGAGAAGGATCCAGCAAGG + Intronic
1040960529 8:53027367-53027389 CAGTGCAGCAGGGGCAAAGAAGG + Intergenic
1041698524 8:60762828-60762850 CAGAGGAGTGGGAGCGAAGAGGG + Intronic
1041737001 8:61121381-61121403 CGGTGAATAAGGAGCCAAGATGG - Intronic
1041950031 8:63490318-63490340 CAACGGGGGAGGAGCCAAGATGG - Intergenic
1042101336 8:65278626-65278648 CAGAGATGAAGAAGCCAAGAAGG + Intergenic
1042487073 8:69357416-69357438 CCTGGGAGGAGGAGCCAAGATGG - Intergenic
1042773514 8:72404799-72404821 GACTGGGGGAGGAGCCAAGATGG + Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1042977980 8:74492162-74492184 CAGTGATCAAGGAGTCAAGAAGG + Intergenic
1043171586 8:76972827-76972849 CAGTGGGGTGGGGGCCAAGATGG - Intergenic
1043302015 8:78745101-78745123 GAGTGGGGAAGTGGCCAAGATGG - Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044131668 8:88531266-88531288 CAATGAATAAGGAGCAAAGACGG - Intergenic
1045087328 8:98700500-98700522 TATTGGGGAAGCAGCCAAGATGG - Intronic
1045268783 8:100644133-100644155 CAGAGGGGAAGCAGCCAAGTTGG + Intronic
1045733085 8:105264101-105264123 TATTGAAGAAGGGGCCAAGATGG - Intronic
1046073084 8:109282166-109282188 CCGGGGAGTAGGGGCCAAGATGG - Intronic
1046553967 8:115753158-115753180 GGATGGAGGAGGAGCCAAGATGG + Intronic
1046692595 8:117302921-117302943 CAGGTTAGAGGGAGCCAAGAGGG - Intergenic
1047149452 8:122244415-122244437 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
1047298093 8:123588872-123588894 AAGTGTAGAAGGAGCCAAGGTGG + Intergenic
1047347266 8:124040303-124040325 CAGTGGGGAAGGAGCAAATGAGG + Intronic
1047628275 8:126678724-126678746 CTGTTGAGAAACAGCCAAGAGGG - Intergenic
1047840268 8:128744600-128744622 CAGAGAGGGAGGAGCCAAGATGG + Intergenic
1048316243 8:133364594-133364616 CAGTGAAGAAGCAGGCAACATGG + Intergenic
1048868878 8:138781048-138781070 CAGTGGAGAACGTGCCAGGAAGG + Intronic
1049872478 8:144991245-144991267 CATTGAGGAAGGAGCCAAGATGG - Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050596607 9:7210887-7210909 CGGTGGAGAAGGAGCCACTTGGG - Intergenic
1050629340 9:7542214-7542236 CAGTGCAGAGGCTGCCAAGAGGG - Intergenic
1050689049 9:8204580-8204602 CAGGGAAGGAGGAGCCAAGATGG - Intergenic
1051298961 9:15628034-15628056 CACTGGGGAGGGAGCCAAGATGG + Intronic
1051956100 9:22695818-22695840 CAATGGAGAAGGGACCAAGAAGG + Intergenic
1052513374 9:29450388-29450410 CCTTAGAGGAGGAGCCAAGATGG + Intergenic
1054819318 9:69506048-69506070 AAAAGGAGGAGGAGCCAAGATGG + Intronic
1055381446 9:75711606-75711628 CAGTGGAGAAGGAGGCACTCTGG - Intergenic
1055637659 9:78294811-78294833 CAGTGGAGACACAGCAAAGAGGG - Intergenic
1055721844 9:79183265-79183287 TAACGGAGGAGGAGCCAAGATGG - Intergenic
1055881379 9:81008714-81008736 AAGAGGAGGAGGAGCCAAGTAGG + Intergenic
1056161715 9:83902767-83902789 GAAAGGAGGAGGAGCCAAGAAGG + Intronic
1056258417 9:84823997-84824019 CAGTGGGGGAGGAGCTAAGCAGG + Intronic
1057086365 9:92214405-92214427 AATTGGGGGAGGAGCCAAGATGG + Intronic
1057407224 9:94783596-94783618 CAGTGGAGAAGGAGGCCAGGAGG + Intronic
1057725635 9:97566078-97566100 CATTGGACCAGGAGCCATGAGGG + Intronic
1057844055 9:98508274-98508296 CTGGGGAGGAGGAGCCAAGATGG + Intronic
1057965438 9:99498737-99498759 AGGTAGAGGAGGAGCCAAGATGG + Intergenic
1058176039 9:101737745-101737767 CAGCCGAGCAGGAGCCCAGAGGG - Exonic
1059007250 9:110417099-110417121 TGGAGGAGGAGGAGCCAAGATGG + Intronic
1059732626 9:117072018-117072040 GAGTGGGGGAGGAGCCAAGATGG - Intronic
1059921910 9:119169113-119169135 ATGTGGCGGAGGAGCCAAGATGG + Intronic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060550683 9:124483640-124483662 CAGTGATGATGGAGACAAGATGG - Intronic
1060568610 9:124617067-124617089 CAGTAGAGGAAGAGCCAAGATGG + Intronic
1060730882 9:126036277-126036299 CAGTGGAGGTGGGGACAAGAGGG - Intergenic
1061758831 9:132835615-132835637 CAGAGGAGAATGAGGCCAGAGGG - Intronic
1062196111 9:135275129-135275151 CAGAGGAAAATGAACCAAGACGG - Intergenic
1203772656 EBV:57521-57543 AAGTGGAGAAGGAGCCGGGGCGG + Intergenic
1203772667 EBV:57572-57594 AAGTGGAGAAGGAGCCGGGGCGG + Intergenic
1203691309 Un_GL000214v1:45637-45659 AATGGGAGAAGGAGCCAAGCTGG - Intergenic
1203358929 Un_KI270442v1:193852-193874 TAGGGGAGGAGGAGCCAAGATGG - Intergenic
1203710761 Un_KI270742v1:95137-95159 AATGGGAGGAGGAGCCAAGATGG + Intergenic
1203540293 Un_KI270743v1:82309-82331 AATGGGAGGAGGAGCCAAGATGG - Intergenic
1203644986 Un_KI270751v1:58554-58576 AATGGGAGAAGGAGCCAAGCTGG + Intergenic
1185648105 X:1629388-1629410 CAGGTGAGATGGAGCCAAGAAGG - Intronic
1186664920 X:11707245-11707267 AAGGGGGGGAGGAGCCAAGATGG + Intergenic
1186687574 X:11941296-11941318 CAGGGAGGGAGGAGCCAAGATGG - Intergenic
1186705868 X:12138703-12138725 CAATGGAGAGGGAGCCAGGCAGG - Exonic
1186905880 X:14109958-14109980 GAGTCGGGGAGGAGCCAAGATGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187421924 X:19142665-19142687 AACGGGAGGAGGAGCCAAGATGG + Intergenic
1188025378 X:25202801-25202823 CAGTGGAGAATGAGTAAAGGAGG + Intergenic
1188240766 X:27786630-27786652 CAGTAGAGCAGGAGGAAAGAAGG - Intergenic
1188354764 X:29177134-29177156 CAGTGGAGAAGAAACAAATAAGG + Intronic
1189042782 X:37560503-37560525 CAGACTGGAAGGAGCCAAGATGG + Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190403173 X:50060140-50060162 CACGGGGGGAGGAGCCAAGATGG + Intronic
1191027961 X:55936387-55936409 TAGTCGAGGTGGAGCCAAGATGG + Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191098091 X:56695881-56695903 CAGGGGAGGAGGAGCCAAGATGG + Intergenic
1191125926 X:56953805-56953827 CTGGGGGGGAGGAGCCAAGATGG - Intergenic
1191698979 X:64019268-64019290 CTCGGGAGGAGGAGCCAAGATGG - Intergenic
1191827197 X:65378593-65378615 GAGTGGGGGAGGAGCCAAGATGG + Intronic
1191855343 X:65620717-65620739 TGGAGGAGGAGGAGCCAAGATGG - Intronic
1192390104 X:70716910-70716932 AATTGGAGGTGGAGCCAAGATGG - Intronic
1192401260 X:70838495-70838517 TAGAGGGGGAGGAGCCAAGATGG + Intronic
1192502198 X:71661531-71661553 CAGTGGTGAAGGATCCGTGAAGG - Intergenic
1192509383 X:71712921-71712943 CAGTGGTGAAGGATCCATGAAGG - Intergenic
1192511348 X:71722244-71722266 CAGTGGTGAAGGATCCATGAAGG + Intergenic
1192515349 X:71759261-71759283 CAGTGGTGAAGGATCCATGAAGG - Intergenic
1192517314 X:71768632-71768654 CAGTGGTGAAGGATCCATGAAGG + Intergenic
1192522272 X:71813412-71813434 CAGTGGTGAAGGATCCGCGAAGG - Intergenic
1193244449 X:79211815-79211837 CAAAGAAGGAGGAGCCAAGATGG - Intergenic
1193303931 X:79926796-79926818 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
1193790319 X:85808700-85808722 CAGTTGAGGTGGAGCCCAGAGGG - Intergenic
1193896050 X:87116303-87116325 CAGAGGAGGAGGAGCCAAGATGG + Intergenic
1193952741 X:87821404-87821426 CTCAGGAGGAGGAGCCAAGATGG + Intergenic
1194068600 X:89292625-89292647 ATGTTGAGGAGGAGCCAAGATGG + Intergenic
1194255270 X:91627093-91627115 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1194303482 X:92215058-92215080 CACTGGGGAAGCAGCCAAGATGG + Intronic
1194442304 X:93947761-93947783 CAGTGCAGAAGAACCCAAAATGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195213229 X:102670317-102670339 AACTGGAGAAGGGCCCAAGATGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195659545 X:107364332-107364354 TAGGAGAGGAGGAGCCAAGATGG + Intergenic
1196171149 X:112590120-112590142 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1196359623 X:114836714-114836736 CCGAGGGGGAGGAGCCAAGATGG - Intronic
1196478727 X:116121198-116121220 CAGCGGAGGTGGAGCCAAGATGG + Intergenic
1197491551 X:127122711-127122733 AAGGGGGGGAGGAGCCAAGATGG - Intergenic
1197623700 X:128780438-128780460 CACTGCTGAAGGTGCCAAGATGG + Intergenic
1197682427 X:129400712-129400734 CACTGGAGAAGGAGCAAACAAGG + Intergenic
1198060670 X:133042642-133042664 CCTTGGAGGAGGGGCCAAGATGG - Intronic
1198928605 X:141826811-141826833 CAGAGAAGAAGGAGCCCAAAAGG - Intergenic
1199547025 X:149017297-149017319 CAGAGGAGATGGAACCAGGAGGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1200204202 X:154304131-154304153 CAGTGGAGAAGGGACCGAGAAGG - Intronic
1200573998 Y:4866354-4866376 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1200581476 Y:4954923-4954945 TAGAGGGGGAGGAGCCAAGATGG - Intergenic
1200722746 Y:6626780-6626802 ATGTTGAGGAGGAGCCAAGATGG + Intergenic
1201014732 Y:9589711-9589733 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1201118577 Y:10855649-10855671 AATGGGAGGAGGAGCCAAGATGG - Intergenic
1201346697 Y:12992003-12992025 AAGAGGAGGTGGAGCCAAGAGGG - Intergenic
1201418927 Y:13776715-13776737 TATGGGAGGAGGAGCCAAGATGG - Intergenic
1202066948 Y:20950145-20950167 GAGGGGAGGAGGAGCCAAGATGG - Intergenic
1202277885 Y:23144664-23144686 GGGTGGGGGAGGAGCCAAGATGG + Intronic
1202287318 Y:23264103-23264125 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1202383555 Y:24300422-24300444 GAGAGGAGGAGGAGCCAAGATGG - Intergenic
1202430711 Y:24776003-24776025 GGGTGGGGGAGGAGCCAAGATGG + Intronic
1202439258 Y:24882160-24882182 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1202487228 Y:25369698-25369720 GAGAGGAGGAGGAGCCAAGATGG + Intergenic