ID: 1150903570

View in Genome Browser
Species Human (GRCh38)
Location 17:69312150-69312172
Sequence ATGCTATTAATGATTAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 329}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150903570_1150903571 14 Left 1150903570 17:69312150-69312172 CCTTGTTTAATCATTAATAGCAT 0: 1
1: 0
2: 4
3: 44
4: 329
Right 1150903571 17:69312187-69312209 CTTTCTCCAGCTTTTGCTTTAGG 0: 1
1: 0
2: 0
3: 51
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150903570 Original CRISPR ATGCTATTAATGATTAAACA AGG (reversed) Intronic
900024861 1:262766-262788 ATGGTATAAATAATTAAACAAGG - Intergenic
900028468 1:352166-352188 ATGGTATAAATAATTAAACAAGG - Intergenic
900816034 1:4846605-4846627 ATGTTCTTAATGAGTATACAAGG - Intergenic
903199052 1:21718249-21718271 ATGCAATTAATCAATAAAAAGGG + Intronic
904692672 1:32305933-32305955 ATGCAATGAATGAATAAAAATGG - Intronic
905019794 1:34801249-34801271 CTATTATTAATTATTAAACAGGG + Intronic
905304856 1:37010547-37010569 GTGCTATTCATAATTACACAAGG + Intronic
907570353 1:55477527-55477549 ATGGTATTCATGCTGAAACAAGG - Intergenic
907589073 1:55648450-55648472 AGGCTATTGATGATGAAAAATGG + Intergenic
908349211 1:63267726-63267748 ATGCTAATAATGATGGAAAAAGG + Intergenic
909064659 1:70920507-70920529 AAGTTATTAATGATTAATTAAGG + Intronic
909166335 1:72230849-72230871 CTGCCATTCATGATTCAACATGG + Intronic
909544863 1:76834967-76834989 ATGTTTTTAATCATTAAAGAAGG - Intergenic
910073910 1:83253665-83253687 ATGCTATCAATTATTGAAAAAGG + Intergenic
910237849 1:85053300-85053322 ATGATATAAAAGATTAAAAATGG - Intronic
910658765 1:89647239-89647261 ATGCTATTATGTATCAAACATGG + Intronic
911029995 1:93476939-93476961 ATTTTACTAATGATGAAACAAGG + Intronic
911305766 1:96230276-96230298 ATGCTTCTAATAATTAAACCTGG - Intergenic
911501996 1:98698482-98698504 ATGTTATTATTGATTACACTTGG + Intronic
911558798 1:99379046-99379068 ATACTATTATTGATTATATATGG - Intergenic
911808438 1:102242311-102242333 TTGCTTTTAATGACTAAACTTGG + Intergenic
912995019 1:114524031-114524053 ATACTATTAATAATTACACTGGG + Intergenic
914808933 1:151012381-151012403 GTGCTATTAATGATTACACAGGG - Intronic
915770272 1:158414944-158414966 TTGCTAATAAAGATTAATCAAGG + Intergenic
916000073 1:160606909-160606931 ATGCTATTAATAATTACCCTGGG - Intergenic
916856084 1:168751697-168751719 ATGCTACTAATTTTTACACATGG - Intergenic
917309520 1:173664240-173664262 ATGCTATTAAAAATTATACCAGG - Intronic
917393730 1:174568509-174568531 ATGCTAACAATGATAAAAAATGG - Intronic
918273706 1:182929545-182929567 AAGGCATTAATGATTAGACAAGG + Intronic
918281692 1:183012318-183012340 ATGCTATTAAAAATAAGACAAGG + Intergenic
918960359 1:191267608-191267630 AGGATATTATTGACTAAACAAGG + Intergenic
919494222 1:198243721-198243743 ATGCCATTAATCATTAAAACCGG - Intronic
919545890 1:198917989-198918011 AAGCTAGAAATGATTAAACTGGG + Intergenic
919966094 1:202526573-202526595 ATGATAATAATGATAAATCATGG + Intronic
920680328 1:208067569-208067591 ATGATATAAAAGATTAAAAATGG - Intronic
920722138 1:208397817-208397839 GTGCTATTAATAATTACACTGGG + Intergenic
924956381 1:248931837-248931859 ATGGTATAAATAATTAAACAAGG + Intergenic
1063584723 10:7341770-7341792 GTGGTAATATTGATTAAACAAGG + Intronic
1064788886 10:18932774-18932796 GTGCTATTAATTTTTAAAGATGG - Intergenic
1065686658 10:28292031-28292053 ATGGTAAAAAAGATTAAACATGG - Intronic
1065924185 10:30421397-30421419 ATGCTATTAAACATTAGAAAAGG + Intergenic
1066433733 10:35377326-35377348 ATGGTATAAAAGATTAAAAATGG - Intronic
1066517772 10:36183007-36183029 ATGCCACTAATGATTAAGCCAGG - Intergenic
1068140765 10:53004142-53004164 ATACTTTTAATGAGTAAACTTGG + Intergenic
1068772271 10:60835532-60835554 ATACTATGAAAGATAAAACATGG + Intergenic
1069411560 10:68159216-68159238 ATGCTATTAATAATTATACAGGG + Intronic
1070109209 10:73466256-73466278 ATGCTATGAGTATTTAAACAAGG - Intronic
1070271464 10:74960409-74960431 TTGCTATTAATTTTTAAAGATGG - Intronic
1073031294 10:100528117-100528139 ATGCTATAAAAGATAAAAAATGG - Intronic
1073781086 10:106839153-106839175 AAGCTACAAATGATTAAACTTGG + Intronic
1073934905 10:108619380-108619402 AGGCTAAAAATGATTAAAAACGG - Intergenic
1075354531 10:121759058-121759080 AGGCTAGAAATGATTAAACATGG + Intronic
1075880804 10:125849074-125849096 ATGCTATTAATGATTAAGCTGGG - Intronic
1076962182 10:133772724-133772746 ATGGTATAAATAATTAAACAAGG + Intergenic
1079322723 11:19464910-19464932 ATTCCATTAAAGACTAAACAGGG - Intronic
1079611840 11:22442346-22442368 ATTTTATGAATGATTAAACTAGG + Intergenic
1079927631 11:26514574-26514596 ATGCTATAAATGAAAAAGCATGG - Intronic
1081318278 11:41659020-41659042 ATTCCATTAATGATTAAAATAGG - Intergenic
1081819070 11:45973622-45973644 ATGCTATTTATTATTAGAAATGG + Intronic
1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG + Intergenic
1083498790 11:63083815-63083837 ATGATATAAATGATTGGACATGG + Intronic
1084197065 11:67529303-67529325 AAACTATGAATGAGTAAACAAGG + Intergenic
1084992743 11:72943511-72943533 AAGCTATTAATAAATAACCAAGG - Intronic
1085798102 11:79562355-79562377 ATGCTATTAAAAATTATACTGGG + Intergenic
1085887956 11:80542743-80542765 ATACTATTAATAAAGAAACAAGG - Intergenic
1087027508 11:93664411-93664433 ATGCTATACATGAAGAAACAAGG - Intronic
1087259189 11:95991818-95991840 ATCTTATTAAAGATCAAACATGG + Intronic
1087827543 11:102783266-102783288 ATGGTATTAAAGATAAAAAATGG - Intergenic
1088480660 11:110293897-110293919 ATGCTACTAATGTTTAAAAACGG - Intronic
1088925721 11:114299601-114299623 ATGCTATCAATCATTTAAGAAGG - Intronic
1090153588 11:124412239-124412261 ATGGTATAAAAGATTAAAAATGG + Intergenic
1092053383 12:5489398-5489420 ATGTTATTAATGATGACACTCGG - Intronic
1092467628 12:8747485-8747507 ATGGTATTAACTTTTAAACATGG - Intronic
1093859712 12:24149067-24149089 ATGCTAATATTGATTCAAAATGG + Intergenic
1094587957 12:31795244-31795266 GTGCTATTAATAATTACACCAGG + Intergenic
1095282898 12:40376782-40376804 ATGATATCAAAGATTAAATATGG - Intergenic
1095355673 12:41271378-41271400 ATGCTATAGATGCTTAAAAATGG - Intronic
1096376205 12:51113033-51113055 CTCCTATTAATGATCAAACTGGG + Intronic
1097462396 12:59878217-59878239 ATGGTATAAAAGATTAAAAATGG + Intergenic
1097932024 12:65198246-65198268 ATACTATAATTTATTAAACATGG - Intronic
1098582705 12:72120024-72120046 ATGCTATTATTGATAAAGTAAGG + Intronic
1099175473 12:79416921-79416943 TTGCTATTTATGACTACACAGGG - Intronic
1099561703 12:84185357-84185379 AAGTTATTAATTATTAAACTTGG + Intergenic
1100093303 12:90999191-90999213 ATGATATTAAGGATTATAGAGGG + Intronic
1100460506 12:94794770-94794792 ATGCTGTTAATAATGACACAAGG + Intergenic
1101588576 12:106106882-106106904 AGGGTACTGATGATTAAACATGG + Intronic
1102014735 12:109640477-109640499 ATGCAGTTAGTGACTAAACAGGG + Intergenic
1103339394 12:120213458-120213480 GGGTTATTAATGATTCAACAAGG - Intronic
1105334392 13:19452383-19452405 ATGCTATTAATGAATAACAGGGG + Intronic
1106957743 13:34960582-34960604 ATACTATAAAAGATAAAACATGG - Intronic
1106969204 13:35116134-35116156 AAGCTACCAATGATTTAACAAGG - Intronic
1107000374 13:35537311-35537333 CTTCTATTAATGATTAAGCTAGG - Intronic
1107749597 13:43550356-43550378 ATGCTATTGCTCATTCAACACGG + Intronic
1109238793 13:59857493-59857515 ATGCTCTTAATGGTAAAATATGG + Intronic
1109526505 13:63582369-63582391 ATGCTATTGATTTTTGAACATGG + Intergenic
1109858270 13:68162391-68162413 AAGCAATTAATAATAAAACATGG - Intergenic
1110591687 13:77269911-77269933 GTGATATTACTGATTAAACAAGG + Intronic
1111101528 13:83594603-83594625 ATTATATTAATCAATAAACATGG + Intergenic
1112110687 13:96294912-96294934 ATGCTATTAAGGATTAGGCAGGG - Intronic
1112414438 13:99192533-99192555 ATGATATAAAAGATTAAAAATGG - Intergenic
1113027532 13:105957453-105957475 ATGGTGTTAATGAATAACCATGG + Intergenic
1113355431 13:109575513-109575535 ATGCAGTTAGTGAATAAACAGGG + Intergenic
1114592524 14:23880168-23880190 TTGCTATTTGTGAATAAACATGG - Intergenic
1115184790 14:30674246-30674268 ATACTATTAATGATAAAGTAGGG + Intronic
1116199606 14:41774635-41774657 ATGCTATTAATGTTTTCACCTGG - Intronic
1116413918 14:44658041-44658063 GTGGTATTACTGATTAAAGATGG - Intergenic
1116587662 14:46729807-46729829 ATGTTATTAAGGATGACACATGG - Intergenic
1117607437 14:57444088-57444110 ATGTTATTAATTATTAAAACTGG - Intergenic
1117620793 14:57584464-57584486 ATGGTATTAATGAGTCTACAGGG + Intronic
1119954699 14:78784465-78784487 GTGCTATTAATAATTACACCAGG + Intronic
1120432096 14:84432201-84432223 ATTCTCTTGATTATTAAACAAGG + Intergenic
1120501476 14:85302738-85302760 GTGCTATTAAGGTTTAAATAGGG - Intergenic
1121406417 14:93721795-93721817 GAGCTATTAATGATGAAGCAGGG + Intronic
1122642242 14:103166752-103166774 AAGCTATCCATGATTGAACAGGG + Intergenic
1123223945 14:106882756-106882778 ATGGTATAAATAATTAAACAAGG + Intergenic
1124000145 15:25751752-25751774 AAGCTATTATTGATTAATAATGG + Intronic
1124341490 15:28892374-28892396 ATGGTATAAAAGATAAAACATGG - Intronic
1124345197 15:28917591-28917613 ATGTTAATAATGAGGAAACAGGG - Intronic
1124909929 15:33909819-33909841 ATGTTTTTAATGCTTAAAAAAGG - Intronic
1124965672 15:34431628-34431650 ATGCTATAAAAGATAAAACATGG + Intronic
1124982302 15:34577774-34577796 ATGCTATAAAAGATAAAACATGG + Intronic
1125716962 15:41824855-41824877 ATGCCATTAATAATTACACTGGG - Intronic
1127004215 15:54547596-54547618 ATGCTTTCACTGAATAAACATGG - Intronic
1128928742 15:71683506-71683528 ATGCTATAAAAAATAAAACAGGG + Intronic
1131082672 15:89549873-89549895 ATGCTATTTCTGAATAAAGAGGG + Intergenic
1133574191 16:7072154-7072176 GTGCTATTAATAATTATACCAGG - Intronic
1137838056 16:51613044-51613066 ATGCTATTAACTATTACAGAGGG - Intergenic
1138473163 16:57254653-57254675 ATGCTATTAATATTTATACCAGG + Intronic
1139458809 16:67105958-67105980 ATGCAATTAATAAATAACCATGG + Intergenic
1140084092 16:71778372-71778394 ATATTCTTAAAGATTAAACATGG - Intronic
1141013499 16:80425799-80425821 ATGCTACTTATGATCAAATATGG - Intergenic
1142456293 16:90226612-90226634 ATGGTATAAATAATTAAACAAGG + Intergenic
1150903570 17:69312150-69312172 ATGCTATTAATGATTAAACAAGG - Intronic
1151303691 17:73248763-73248785 ATATTATTCAGGATTAAACAAGG - Exonic
1152495476 17:80668285-80668307 AGGCTAGTAATGAGTAAAAATGG - Intronic
1152951294 17:83234391-83234413 ATGGTATAAATAATTAAACAAGG + Intergenic
1153736574 18:8076090-8076112 ATGCTATTAATAATTTTCCAAGG + Intronic
1155499845 18:26476483-26476505 ATGCTATTGGTGATTTAACATGG + Intronic
1156975324 18:43215000-43215022 AAGCTATTAATGTTGCAACAGGG - Intergenic
1158399802 18:57111680-57111702 ATGATATTAATAATTATACTAGG + Intergenic
1158400674 18:57118615-57118637 ATGCTATTCATGATTATGCTGGG - Intergenic
1158418011 18:57266825-57266847 CGGCTATTAATGATCAAACTTGG - Intergenic
1158801050 18:60909788-60909810 ATACTCTTAAAGACTAAACAAGG + Intergenic
1160654432 19:256027-256049 ATGGTATAAATAATTAAACAAGG - Intergenic
1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG + Intronic
1165868371 19:38952993-38953015 ATGTTTTTAATGATTAACCATGG - Intronic
1166089551 19:40499381-40499403 ATAATAATAATAATTAAACAGGG - Intronic
1167749126 19:51369182-51369204 ATGATAATAATGATAAAAGAAGG - Intergenic
1168727326 19:58593428-58593450 ATGGTATAAATAATTAAACAAGG + Intergenic
925864591 2:8215642-8215664 ATGCTATTAATAATTATTCAAGG + Intergenic
928848033 2:35704250-35704272 AATCTATTTATGATTAAAAAAGG + Intergenic
929413209 2:41720629-41720651 AGGTTTTTAATGATTAAACCAGG + Intergenic
929720008 2:44358613-44358635 ACACTATTAATAATTACACAGGG + Intronic
931509862 2:62979609-62979631 ATACTATTAATGAGGAATCATGG - Intronic
933469025 2:82696533-82696555 ATGCTATTAATAATTATGCCAGG + Intergenic
934984980 2:98878246-98878268 ATGGTATAAAAGATTAAAAATGG - Intronic
935406214 2:102712582-102712604 ATGCTTTTAAATATTAAATACGG + Intergenic
936571226 2:113617766-113617788 ATGGTATAAATAATTAAACAAGG - Intergenic
937330876 2:121028471-121028493 ATGATATTATTGATCTAACAAGG + Intergenic
937566865 2:123303857-123303879 CTGCAATGAATGATTTAACATGG - Intergenic
937649403 2:124303183-124303205 ATGCTGGTAATGATTCAGCAGGG - Intronic
938089319 2:128420923-128420945 GTGCTATTAATAATTATACCAGG - Intergenic
938209528 2:129455806-129455828 ATGCTATTGATTATAACACATGG + Intergenic
939206659 2:139114491-139114513 AAGGTATTTATGATTAAAAATGG - Intergenic
940126862 2:150335852-150335874 AAGCTAGAAATGATTAAACTTGG + Intergenic
940253949 2:151709407-151709429 ATGTTATTAATGCTCATACATGG + Intronic
940635294 2:156292022-156292044 ATTCTGATAAAGATTAAACATGG - Intergenic
940877897 2:158916436-158916458 TTGCTATTAATGAGCAAAGAAGG - Intergenic
941228712 2:162881987-162882009 ATGCTACTAATTATTATACAAGG + Intergenic
943003905 2:182365189-182365211 ATGCTCTTAGTAATTACACAGGG + Intronic
944206039 2:197159644-197159666 ATTACATTTATGATTAAACATGG + Intronic
944353063 2:198753304-198753326 TTTTTATTAATGATTTAACATGG - Intergenic
944774802 2:202952293-202952315 ATGGTCTTAATCATTACACATGG - Intronic
945292639 2:208141286-208141308 ATACTATTAATAATTACACTGGG - Intergenic
945316142 2:208372734-208372756 ATTCTATTAATGATGAAATTAGG + Intronic
945581673 2:211602648-211602670 ATGTGAATAATCATTAAACATGG - Intronic
945664726 2:212726436-212726458 ATGTTATTAATAATTACACCAGG - Intergenic
945934990 2:215894644-215894666 ATTATATTAATGATATAACATGG + Intergenic
946816483 2:223583563-223583585 ATGGTATAAAAGATTAAACATGG - Intergenic
949087786 2:242171410-242171432 ATGGTATAAATAATGAAACAAGG + Intergenic
1168768960 20:402001-402023 ATGATGTTAATGATTAACCGTGG + Intergenic
1170398172 20:15950695-15950717 ATGCTATAAAATTTTAAACATGG - Intronic
1171390156 20:24796227-24796249 ATGCTATTAATTATTAAATAAGG + Intergenic
1174172969 20:48628473-48628495 ATACTATTAACTATGAAACAGGG + Intronic
1174496182 20:50944848-50944870 ATGCTAGCTATCATTAAACATGG - Intronic
1174886887 20:54345599-54345621 GGGCTATTAATTATTAAGCATGG + Intergenic
1175285005 20:57831961-57831983 ATGCAATGAATGATTGAAGAGGG - Intergenic
1177168111 21:17625744-17625766 ATGCTGTTGATAATTAAACGAGG - Intergenic
1177349673 21:19920870-19920892 ATAATATTCATGATTAAACCAGG - Intergenic
1180262765 21:46685230-46685252 ATGGTATAAATAATTAAACAAGG + Intergenic
1181996642 22:26888072-26888094 ATGCTATTAATCAATAAGCCAGG - Intergenic
1182670748 22:31993754-31993776 AGGCTATGAGTGAATAAACAAGG + Intergenic
1183819728 22:40336246-40336268 GTGCAAATTATGATTAAACAAGG - Intergenic
1185428966 22:50793104-50793126 ATGGTATAAATAATTAAACAAGG + Intergenic
949132286 3:518171-518193 ATGGTATAAAAGATTAAAAATGG - Intergenic
949711707 3:6878084-6878106 AAGCTATTAAAGATTAAAACTGG - Intronic
952350388 3:32530353-32530375 ATGCTATGAATGTCTAAACTAGG - Intronic
952815069 3:37440590-37440612 ATACTATAAAAGATTAAAAATGG - Intergenic
955028409 3:55192304-55192326 ATGCAATTAAGGATGAATCATGG + Intergenic
956244599 3:67168243-67168265 ATGCAAAACATGATTAAACAGGG + Intergenic
957706378 3:83791791-83791813 TTGCTATAAATGATTACATAAGG + Intergenic
958439540 3:94138965-94138987 AAGCTATTAATAATTACACCAGG + Intergenic
958493899 3:94817378-94817400 ATGCCATTAAGGAATAAAAAAGG + Intergenic
958709709 3:97702900-97702922 ATGCTATTGATGATAAAATGGGG - Intronic
959269312 3:104185821-104185843 ATGCTTTTAATATTTAACCAAGG - Intergenic
960287299 3:115844116-115844138 ATGCTATAAATCATTAAAATAGG - Intronic
961618587 3:128205163-128205185 AATCAATAAATGATTAAACAAGG - Intronic
962419248 3:135213927-135213949 ATGCAATTCATGATAATACAGGG - Intronic
963666409 3:148193302-148193324 ATTATATTAATGATGAAAAAGGG - Intergenic
964109007 3:153069596-153069618 ATGTTATTAATGTTTAAATTTGG + Intergenic
964588307 3:158332325-158332347 ATGATATAGATGATCAAACACGG - Intronic
964987323 3:162759956-162759978 ATGGTATTAAAAATTAAAAATGG - Intergenic
965501765 3:169465176-169465198 ATGCTCTTAACCTTTAAACAAGG - Intronic
966324586 3:178739840-178739862 ATGCTATTAATAATTATGCTAGG + Intronic
966564940 3:181367999-181368021 TTGCTATTAATGAAGAAAAAAGG - Intergenic
966622717 3:181983363-181983385 ATGCCATTAATAATTACACAAGG + Intergenic
966702363 3:182868914-182868936 ATGCCATTAATAACAAAACAGGG - Intronic
966909243 3:184549488-184549510 GTGCTATTAATAATTACACTGGG - Intronic
967414934 3:189205831-189205853 GTGCTAGTAATGATCACACATGG - Intronic
967753831 3:193145981-193146003 ATGCTATTAATGGTCACAAATGG - Intergenic
968004635 3:195233368-195233390 ATGTTATTATTGATTAAGTAAGG + Intronic
968205813 3:196799246-196799268 CTGCAATGAATGATTAAAAAGGG + Intronic
969960104 4:10936050-10936072 ATTCAGTTAGTGATTAAACACGG - Intergenic
970030678 4:11670669-11670691 ATGCTATTAACAATTAAACTTGG - Intergenic
970142139 4:12994327-12994349 ATGAAATTAATAATTAAAAAAGG - Intergenic
970289802 4:14559908-14559930 AGGTAATTAATGATTCAACATGG - Intergenic
970404868 4:15753489-15753511 ATGCTACTAATAATTATGCAAGG - Intergenic
972661939 4:41124688-41124710 ATTCTACAACTGATTAAACATGG + Intronic
974018238 4:56669395-56669417 GTGCTATTAATAATTACACCAGG + Intronic
974330893 4:60477204-60477226 ATCCTATCAATGATGAAAAATGG - Intergenic
974697625 4:65396662-65396684 AAGCTATTCATGATAGAACAGGG + Intronic
974881107 4:67758301-67758323 ATGCTATGCATAATTTAACATGG - Intergenic
975111258 4:70629918-70629940 ATGAGATGAATGATTAAGCAAGG + Intronic
975116303 4:70684743-70684765 GTGCTATTAATAATTACACTGGG + Intronic
975235863 4:71996203-71996225 ATGCTATAAATCAATAAATAAGG + Intergenic
975691374 4:76967327-76967349 ATGCCATCAATAATTCAACACGG - Intronic
975812980 4:78188860-78188882 ATGCTATAAATGACTATAAAAGG + Intronic
975903912 4:79187154-79187176 AAGCAATTGATGATAAAACATGG - Intergenic
977007530 4:91589304-91589326 ATGCTAATAAGGACTAAAAAAGG + Intronic
977429260 4:96911139-96911161 ATGCCATTAATTTTTAAATAAGG + Intergenic
977800470 4:101224160-101224182 GTGCTATTAATAATTACACTGGG + Intronic
978702435 4:111664266-111664288 GTGCTATTAATAGTTATACAAGG - Intergenic
978715509 4:111838034-111838056 ATGATATAAAAGATTAAAAATGG - Intergenic
979198514 4:117948826-117948848 ATTCTATTAATTCATAAACATGG - Intergenic
979393842 4:120161820-120161842 ATGGTATAAAAGATTAAAAATGG + Intergenic
980304834 4:131045927-131045949 ATGGTTTTAGTGATTAAATAAGG - Intergenic
980802035 4:137764240-137764262 AGGATATAAAAGATTAAACATGG - Intergenic
981222432 4:142253126-142253148 ATGGTATAAAAGATTAAAAATGG + Intronic
981333777 4:143543553-143543575 ATGCTTCAAATGATTAGACATGG + Exonic
982755650 4:159215651-159215673 ATGTTGTTTATGATTAAATATGG - Intronic
982996230 4:162350669-162350691 ATGGTATAAAAGATTAAACATGG + Intergenic
983002806 4:162439551-162439573 ATACTTTTAATGACTCAACATGG + Intergenic
983679691 4:170339107-170339129 AAGCTAATAATGCTTAAACGTGG - Intergenic
984018591 4:174456213-174456235 AAGCTATGAATAATAAAACATGG + Intergenic
984684788 4:182655125-182655147 ATGTTATTAATGTATAAAAAAGG - Intronic
985038581 4:185865889-185865911 TTTCTTTTAATGATAAAACAGGG + Intronic
985465414 4:190190204-190190226 ATGGTATAAATAATTAAACAAGG + Intergenic
985468192 5:17887-17909 ATGGTATAAATAATTAAACAAGG - Intergenic
985876156 5:2597922-2597944 AAGCTATTAATGGGAAAACAAGG + Intergenic
987242425 5:16014257-16014279 ATGCTACTAATCTGTAAACAAGG + Intergenic
988172498 5:27677625-27677647 ATGCTATTCATGAGAAGACATGG + Intergenic
990171760 5:53059144-53059166 ATGCTATAAATCATCAAACGAGG - Intronic
990464427 5:56058519-56058541 ATGTTACTAATGATGGAACACGG - Intergenic
990733526 5:58835012-58835034 ATGCTATTAATACTTACACTGGG - Intronic
991027647 5:62047870-62047892 ATGCTACTCATTATTGAACATGG + Intergenic
993010122 5:82471427-82471449 ATGATGTTAATGATTAAAATAGG - Intergenic
993464051 5:88222827-88222849 ATTGTATTATTGATTACACAAGG - Intronic
993469007 5:88283949-88283971 GTGCTATTAATCATTACACCAGG - Intergenic
993658899 5:90606074-90606096 ATGCTTTTAATGATCATACAAGG - Intronic
993823095 5:92645194-92645216 ATGCTAATAATGATTGCAAAGGG - Intergenic
995800902 5:115993510-115993532 TTGCTTTTAATAATTGAACATGG + Intronic
995891231 5:116954358-116954380 ATGCAAATAATGAATAAACTAGG - Intergenic
997835468 5:137188738-137188760 AAGCTATAAATGATTAAACTTGG + Intronic
998663119 5:144263049-144263071 GTGCTATTAATGATTATGCCTGG + Intronic
998786295 5:145712564-145712586 ATGCTATTTATCCTTAAAAAAGG - Intronic
998899054 5:146832689-146832711 ATGATATAAATGATTAAAAATGG - Intronic
1001346477 5:170904201-170904223 AAGCTAATAATGAATAAAAATGG - Intronic
1002745522 5:181468205-181468227 ATGGTATAAATAATTAAACAAGG + Intergenic
1002813026 6:652249-652271 ATGCTATTAAAGTTATAACATGG - Intronic
1005134007 6:22545852-22545874 ATACTATAAATGAATACACATGG + Intergenic
1005426879 6:25712145-25712167 AGGTTATTAATTATTCAACATGG - Intergenic
1005888288 6:30114034-30114056 GTGCTATTAATAATTACACCAGG - Intergenic
1005898987 6:30201158-30201180 ATACTATTAATGATTATGTATGG + Intronic
1007672048 6:43563749-43563771 ATGGTATAAATGATAAAAGATGG + Intronic
1008214612 6:48772382-48772404 ATGCTATTAAATATTAATCTAGG - Intergenic
1008713970 6:54265769-54265791 ATGCCATTAATAGTGAAACAAGG + Intronic
1008851867 6:56032371-56032393 ATGCTCTTAATAGTCAAACATGG + Intergenic
1009054753 6:58321309-58321331 TTCCTATTATTTATTAAACAGGG - Intergenic
1009320519 6:62282705-62282727 ATATTATTAATCATTAAACTAGG + Intronic
1012023115 6:93951417-93951439 ATTCTATTAATGAATAGATAAGG + Intergenic
1012565856 6:100650102-100650124 ATATTTTTAATCATTAAACAAGG - Intronic
1013083836 6:106838202-106838224 AAGCTATTAATTACTAAATATGG + Intergenic
1013738710 6:113258626-113258648 ATGCAATGAATGAACAAACAAGG - Intergenic
1014326621 6:120004508-120004530 AACTTATTAATGAATAAACATGG - Intergenic
1014397822 6:120948164-120948186 GTGATATTAATGAAGAAACATGG - Intergenic
1014886498 6:126787839-126787861 GTGCTATTAATAATTAAGCTGGG - Intergenic
1015385068 6:132612866-132612888 ACGCAGTTAATGATTACACAGGG + Intergenic
1016176928 6:141090360-141090382 ATGGTATGAAAGATAAAACATGG + Intergenic
1016952644 6:149595708-149595730 CTGCTATTAAGGATAAAACTTGG - Intronic
1018426747 6:163690059-163690081 ATGCTTTTAATTCATAAACAAGG + Intergenic
1019234544 6:170599280-170599302 ATGGTATAAATAATTAAACAAGG + Intergenic
1019250440 6:170741754-170741776 ATGGTATAAATAATTAAACAAGG + Intergenic
1020351825 7:7228238-7228260 ATGCTATTCATTGTTAAAAAAGG - Intronic
1020505769 7:8985941-8985963 ATGGTATAAAAGATTAAAAATGG + Intergenic
1020671853 7:11125526-11125548 ATTCTTTTGATTATTAAACAAGG + Intronic
1021292736 7:18865953-18865975 ATGCTATTATAAATTATACAGGG + Intronic
1021962467 7:25886586-25886608 AGGCTATTAATAGTTAAGCAAGG - Intergenic
1022681640 7:32553265-32553287 TGGCAATCAATGATTAAACAAGG - Intronic
1024693663 7:51832119-51832141 ATACTATTAATGGTTAAAGAGGG + Intergenic
1026395979 7:69954795-69954817 ATGCCACTAATGATTGAACTGGG - Intronic
1028012135 7:85659369-85659391 ATGATATTGATTGTTAAACAGGG - Intergenic
1028066199 7:86388049-86388071 ATACTATTAATTAATAAAAAAGG - Intergenic
1031547766 7:123070578-123070600 TTGCTATGAAAAATTAAACAGGG + Intergenic
1032733444 7:134667333-134667355 ATGCTATTAATAATTACATTCGG - Intronic
1033164076 7:139023693-139023715 ATTCTATTAAAGATTAAAACAGG + Intergenic
1033780013 7:144657846-144657868 TGGCAATAAATGATTAAACATGG + Intronic
1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG + Intronic
1034177555 7:149112223-149112245 ATGCTATTAATCAGCGAACAGGG - Exonic
1034488213 7:151379472-151379494 TTGCTATGAATGAAGAAACAAGG - Intronic
1034596431 7:152198456-152198478 ATGCAATTAATGGTAAAAAAAGG + Intronic
1034941723 7:155234982-155235004 AGGTGATTAATGATTAAACTGGG + Intergenic
1035052799 7:156011812-156011834 ATGGTATTAAAGATAAAAAATGG + Intergenic
1035514112 8:217452-217474 ATGGTATAAATAATTAAACAAGG - Intergenic
1036603942 8:10289893-10289915 ATACTAATAATGATCAACCATGG - Intronic
1037742305 8:21617290-21617312 ATGCTATTAATATTAAAACTGGG - Intergenic
1038148478 8:24919996-24920018 ATCCTATTAATGAAAAAACATGG - Intergenic
1038611513 8:29063910-29063932 AGGCCATTAAAGAATAAACATGG + Intronic
1039455550 8:37703644-37703666 ATGCTTTTCCTGTTTAAACAGGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041159380 8:55022800-55022822 ATGGTATTAATGGTGAAAAATGG + Intergenic
1042095768 8:65214220-65214242 ATGCTATTAATGAAGAAAATGGG + Intergenic
1042648818 8:71016755-71016777 ATGGCATTAACAATTAAACAGGG + Intergenic
1042788332 8:72574407-72574429 ATGCTATTAATAATTAGACTGGG - Intronic
1045440908 8:102209575-102209597 GTTCTTCTAATGATTAAACATGG + Intronic
1045966021 8:108025486-108025508 CTGCTATAAATAAGTAAACAAGG + Intronic
1046776557 8:118169942-118169964 ATGAATTTAAAGATTAAACATGG + Intergenic
1048259361 8:132932618-132932640 TGGCAATTAATGATTTAACAGGG - Intronic
1048900781 8:139035555-139035577 ATGCTTTTGCTGATAAAACAAGG + Intergenic
1050833442 9:10044624-10044646 ATGATATTAATGATCTAATATGG - Intronic
1050844710 9:10200423-10200445 ATGCTGCTAAACATTAAACAAGG + Intronic
1050892379 9:10839644-10839666 ATGGTATTAAAGATTAAAAATGG - Intergenic
1054824339 9:69557121-69557143 ATACTATTATTCATAAAACATGG + Intronic
1054962628 9:70985740-70985762 ATGCAATCTATGATTTAACAAGG + Intronic
1056449647 9:86704361-86704383 ATGATATAAAAGATAAAACATGG - Intergenic
1056954019 9:91068080-91068102 ATGGTATAAAAGATAAAACATGG - Intergenic
1057296140 9:93843110-93843132 ATGTTATTATTGATTAAATGTGG + Intergenic
1058611326 9:106779351-106779373 ATTTTATAAATGATAAAACAGGG + Intergenic
1059079698 9:111235128-111235150 ATGGTATAAATGATTTAAAATGG + Intergenic
1059545366 9:115170556-115170578 ATTCTATGAATGAGGAAACAGGG + Intronic
1061340774 9:129979258-129979280 ATGCCATTGATGACTACACACGG - Intronic
1061501241 9:131003680-131003702 ATGCTATAAAAGATTAAAAATGG + Intergenic
1062143028 9:134970192-134970214 ATACTATGAATGAGTAAACCTGG - Intergenic
1203579995 Un_KI270745v1:34354-34376 ATGGTATAAATAATTAAACAAGG + Intergenic
1187984380 X:24794281-24794303 ATGCTAAGAAGAATTAAACAGGG - Intronic
1188084769 X:25890197-25890219 ATGATATAAAAGATTAAAAATGG + Intergenic
1188566144 X:31528828-31528850 ATGCTAATAATAATCACACAGGG + Intronic
1189178387 X:38980611-38980633 ATGGTATTAATGATTTTATAGGG + Intergenic
1189563126 X:42211507-42211529 ATGCTATTAAAGATAAAAAATGG - Intergenic
1189621223 X:42840622-42840644 ATGCTATAAATGATAAAAAATGG - Intergenic
1191803590 X:65108039-65108061 ATGGTATAAAAGATTAAAAATGG + Intergenic
1193509854 X:82385352-82385374 ATTTTTTTAATGATGAAACATGG - Intergenic
1193570500 X:83135989-83136011 ATCCAATTAATGAATAAAAAAGG + Intergenic
1193929833 X:87540081-87540103 ATGATATCAAAGATTAAAGAAGG + Intronic
1193958852 X:87898857-87898879 AAAATATTAATTATTAAACATGG - Intergenic
1194679468 X:96834628-96834650 ATACTATTAAAATTTAAACAAGG - Intronic
1194817850 X:98466588-98466610 ATGCTATGAATAGTAAAACAAGG - Intergenic
1195005091 X:100678067-100678089 ATGCTGTTAATAATGAAAGAAGG - Intronic
1195555026 X:106211767-106211789 ATGCTATAAATGAATGAATAAGG - Intergenic
1195781766 X:108474247-108474269 ATGATATAAAAGATTAAAAATGG - Intronic
1195815509 X:108881457-108881479 ATGCTATAAATGAATCAAAATGG + Intergenic
1196041393 X:111208481-111208503 ATGGTATAAAAGATAAAACATGG - Intronic
1196117191 X:112010667-112010689 ATGATATAAATGATAAAAAATGG + Intronic
1196323254 X:114369329-114369351 ATACAATTAATGAATAAAAAAGG + Intergenic
1197410619 X:126111177-126111199 ATACTATTTATGAATAAAAAGGG + Intergenic
1198724045 X:139657921-139657943 ATGCTATTAATGATAGGAAAGGG - Intronic
1202301705 Y:23422367-23422389 ATGATAATAATGATAAATCATGG + Intergenic
1202569106 Y:26248231-26248253 ATGATAATAATGATAAATCATGG - Intergenic
1202597416 Y:26555817-26555839 ATGCTATTAATGAATAACAGGGG - Intergenic