ID: 1150907490

View in Genome Browser
Species Human (GRCh38)
Location 17:69353579-69353601
Sequence TTGGTGCTATAATCATTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150907484_1150907490 -9 Left 1150907484 17:69353565-69353587 CCCTTATCATCTAATTGGTGCTA No data
Right 1150907490 17:69353579-69353601 TTGGTGCTATAATCATTGGGGGG No data
1150907485_1150907490 -10 Left 1150907485 17:69353566-69353588 CCTTATCATCTAATTGGTGCTAT No data
Right 1150907490 17:69353579-69353601 TTGGTGCTATAATCATTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150907490 Original CRISPR TTGGTGCTATAATCATTGGG GGG Intergenic
No off target data available for this crispr