ID: 1150907995

View in Genome Browser
Species Human (GRCh38)
Location 17:69359122-69359144
Sequence GTGAAGGCTACATTTTTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150907995_1150907997 10 Left 1150907995 17:69359122-69359144 CCGCAAAAAAATGTAGCCTTCAC No data
Right 1150907997 17:69359155-69359177 GCAGAGCCAGCCCACATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150907995 Original CRISPR GTGAAGGCTACATTTTTTTG CGG (reversed) Intergenic
No off target data available for this crispr