ID: 1150909023

View in Genome Browser
Species Human (GRCh38)
Location 17:69369037-69369059
Sequence AACTGTGAACAGTGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150909023_1150909026 27 Left 1150909023 17:69369037-69369059 CCATCTTCCCACTGTTCACAGTT No data
Right 1150909026 17:69369087-69369109 TTGCAGATTAATTAATAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150909023 Original CRISPR AACTGTGAACAGTGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr