ID: 1150915207

View in Genome Browser
Species Human (GRCh38)
Location 17:69429787-69429809
Sequence CAGGATAATCTGATGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 200}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150915207_1150915214 -1 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915214 17:69429809-69429831 GCTGGGGTGTTGATGGCAGCAGG 0: 1
1: 0
2: 0
3: 30
4: 342
1150915207_1150915217 13 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915217 17:69429823-69429845 GGCAGCAGGCTTCAAGTGTGGGG 0: 1
1: 0
2: 2
3: 9
4: 156
1150915207_1150915219 19 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915219 17:69429829-69429851 AGGCTTCAAGTGTGGGGGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 301
1150915207_1150915221 23 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915221 17:69429833-69429855 TTCAAGTGTGGGGGCCAGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 173
1150915207_1150915215 11 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915215 17:69429821-69429843 ATGGCAGCAGGCTTCAAGTGTGG 0: 1
1: 0
2: 1
3: 17
4: 163
1150915207_1150915218 14 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915218 17:69429824-69429846 GCAGCAGGCTTCAAGTGTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 148
1150915207_1150915216 12 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915216 17:69429822-69429844 TGGCAGCAGGCTTCAAGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 117
1150915207_1150915212 -8 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915212 17:69429802-69429824 TTATCCTGCTGGGGTGTTGATGG 0: 1
1: 0
2: 1
3: 19
4: 141
1150915207_1150915220 22 Left 1150915207 17:69429787-69429809 CCATCATCCATCAGATTATCCTG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1150915220 17:69429832-69429854 CTTCAAGTGTGGGGGCCAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150915207 Original CRISPR CAGGATAATCTGATGGATGA TGG (reversed) Intronic
901939995 1:12654697-12654719 CAGGATAAGGTTATGGCTGAAGG + Intronic
902725834 1:18335334-18335356 CAGGAGAATCTTTTGGCTGAGGG - Intronic
902748868 1:18492687-18492709 AATGAACATCTGATGGATGAAGG - Intergenic
903516173 1:23912453-23912475 CAGGATAGCCTGGTGGCTGAAGG + Intronic
907005870 1:50912256-50912278 CAGGTAAATCTGATGTAGGAAGG - Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907644825 1:56231824-56231846 CAAAAGAATTTGATGGATGAAGG + Intergenic
908148441 1:61273252-61273274 CAGGTTAAAATGATGAATGATGG - Intronic
908637452 1:66184024-66184046 CAAGATGATCTGAGGGATGATGG + Intronic
911696029 1:100891483-100891505 AAGGATAATCTGTTGGGTAAGGG + Intronic
914001831 1:143700886-143700908 AAGGATAATTTGGTGGATGGGGG + Intergenic
915744035 1:158142417-158142439 CCTGAAAAGCTGATGGATGAGGG - Intergenic
917698425 1:177554753-177554775 CATGAAAATCAGATGGCTGAGGG - Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
921035787 1:211376907-211376929 AAGGATAATCTCATGGATGGGGG + Intergenic
921082236 1:211750806-211750828 CAGGGTAAGCTGATTCATGAGGG + Intronic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
1062848812 10:727801-727823 CAGGATATGCTCAGGGATGATGG - Intergenic
1063482791 10:6391131-6391153 AAGGATAATTTGGTGGGTGAGGG - Intergenic
1063550831 10:7031151-7031173 CCAGAGAATCTGATGGATGCAGG + Intergenic
1063713023 10:8499163-8499185 CAGGATAATATCATGAATCATGG - Intergenic
1063941322 10:11132914-11132936 CAGGATAATCTAAGAGGTGATGG + Intronic
1064529390 10:16292061-16292083 CAGGATAATTCTATGGATGAGGG - Intergenic
1065460002 10:25950615-25950637 CAGGAGAATATGATGGAAAAAGG + Intronic
1066392487 10:34989089-34989111 AAGGATAATGTGATGTATGTAGG + Intergenic
1070707401 10:78650436-78650458 CAGGATGATTTGGTGGATGGAGG + Intergenic
1072825429 10:98601390-98601412 CTGATTAATCTGATGGATGGAGG - Intronic
1080667920 11:34352025-34352047 CTGGGTAGTCTGAAGGATGAGGG - Intronic
1081777156 11:45683432-45683454 AAGTCTAGTCTGATGGATGAGGG + Intergenic
1083967284 11:66050680-66050702 CAGGATAAACTAAAGGCTGATGG - Intergenic
1084658808 11:70535373-70535395 CTGGTTAGACTGATGGATGATGG - Intronic
1087043190 11:93821327-93821349 CAGGATGATATGCTGGATGTTGG + Intronic
1087797838 11:102473087-102473109 AAGGATAATTTGGTGGATGGGGG + Intronic
1087887076 11:103493855-103493877 AAGGATAATTTGGTGGGTGAAGG - Intergenic
1089532370 11:119138780-119138802 GAAGATAATCTGTTGGATTAAGG + Intergenic
1090256904 11:125290945-125290967 CAGGAGAAGCTGATGGGAGAAGG + Intronic
1090973532 11:131662839-131662861 CAGCTTATTGTGATGGATGAAGG + Intronic
1091521466 12:1248379-1248401 CAGGACACTGTGATAGATGATGG + Intronic
1093330809 12:17836069-17836091 TAAAATAATCTGATAGATGAAGG + Intergenic
1097535420 12:60863828-60863850 CAGGATAAGATGAGGGATGAAGG + Intergenic
1097849760 12:64400283-64400305 AAGGCTGATTTGATGGATGAGGG - Intergenic
1098119733 12:67223205-67223227 CAGGATAGTCTGTGGGATGGAGG + Intergenic
1098711646 12:73770102-73770124 AAGGATAACCTGGTGGATGGGGG - Intergenic
1100278165 12:93091488-93091510 CAGGAGAACCTGATGGGTAAGGG - Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1103173038 12:118838239-118838261 GAAGATAGTCTGATGGATAATGG - Intergenic
1104344081 12:127980107-127980129 CAGGATAAGGTTATGGCTGAAGG + Intergenic
1104723994 12:131065003-131065025 AGGGAGAATCTGATGAATGAGGG - Intronic
1106998144 13:35512254-35512276 GAGGATTACCTGATGGTTGAAGG + Intronic
1108189392 13:47921940-47921962 CAGGCTAATCGGAAGGCTGAGGG + Intergenic
1112539076 13:100289107-100289129 CAGTATAATTTGATGTATGTGGG + Intronic
1113590062 13:111492383-111492405 CCGGAGCATCTGAAGGATGATGG + Intergenic
1114784135 14:25574918-25574940 CAGGATAATTAGATGCATAAAGG + Intergenic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1116744924 14:48805698-48805720 CAGGATAAAGTTATGGCTGAAGG - Intergenic
1118620628 14:67611131-67611153 CAGGGGCATCTTATGGATGACGG - Intergenic
1119862208 14:77944379-77944401 CAGAATAATCTGATGGCAGGAGG + Intergenic
1122317517 14:100834936-100834958 TAGGATCAACTGTTGGATGACGG - Intergenic
1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG + Intronic
1124456966 15:29852326-29852348 CAGGATATTCCGATGGCTAATGG + Intronic
1125934141 15:43620011-43620033 CAGGATAATCGCTTGAATGAAGG - Intergenic
1127422842 15:58824969-58824991 CAAGATAATATGATATATGATGG - Intronic
1130793517 15:87182313-87182335 CAGGAAAATATGATGCATAATGG + Intergenic
1131006136 15:88980035-88980057 CAGGATAAGGTTATGGCTGAAGG - Intergenic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1134027935 16:10968622-10968644 CAGGATCATGTGATGGTTAATGG + Intronic
1135171116 16:20184651-20184673 AAGGATAAAATGATGGATGTGGG - Intergenic
1135910710 16:26558294-26558316 AAGAATAATATGATGGTTGAAGG + Intergenic
1136023099 16:27452429-27452451 CAGGAGAATCTGAGAGATGGAGG + Intergenic
1139287130 16:65825741-65825763 CAGGATAGTGTGAGGGCTGAGGG + Intergenic
1140591116 16:76353785-76353807 AATGATACTCTGATAGATGAAGG - Intronic
1141419465 16:83903463-83903485 GAGGATAAAGTCATGGATGAGGG - Intronic
1144102247 17:11952041-11952063 CAGGAAGCTCTGGTGGATGATGG + Intronic
1144189579 17:12832204-12832226 AAGGATAATTTGATGGATAGGGG + Intronic
1145982492 17:29021372-29021394 CAGGATAAGCTGATAAAGGAAGG - Intronic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1146610786 17:34303252-34303274 CAGGACAATCTGATCAATAAGGG + Intergenic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1149390792 17:56188755-56188777 CAGGATATTCTGAGGGATTTAGG - Intronic
1150737521 17:67753158-67753180 CAGGAATTGCTGATGGATGAGGG - Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151084767 17:71367299-71367321 CAGAATCTTCTGATGGAAGATGG - Intergenic
1156783673 18:40882520-40882542 AAGGATACTCTGATAGTTGAAGG - Intergenic
1156819542 18:41356041-41356063 CAGTATAATCTGGTGGTTAAGGG - Intergenic
1159112623 18:64076831-64076853 AAGGATAATTTGGTGGGTGAGGG - Intergenic
1160695424 19:481648-481670 AAGGATAATGGGAAGGATGATGG + Intergenic
1166234625 19:41446568-41446590 AAGTATAATCTGAGGGATCAAGG + Intergenic
1166821393 19:45582562-45582584 AAGGATAACTTGATGGGTGAGGG + Intronic
1168505487 19:56930436-56930458 CAGGTTCATCTCATGGATGCAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
927017994 2:18987318-18987340 CAGCATAATCAGATGGCTGATGG + Intergenic
927275228 2:21256885-21256907 CAGGAGAATCTGATGGCTCCAGG + Intergenic
927292485 2:21418822-21418844 CAGGATAATCTGATTGAGAGGGG - Intergenic
929011068 2:37445623-37445645 CAGAATAATATCAAGGATGAAGG + Intergenic
929012491 2:37458962-37458984 CAGGATGATTTCCTGGATGAGGG + Intergenic
932908842 2:75784329-75784351 AAGGATAATTTGGTCGATGAAGG + Intergenic
935945383 2:108281498-108281520 AAGGGTAATTTGATGGTTGAAGG - Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
945702077 2:213184336-213184358 CAGGAGAATATTTTGGATGAAGG - Intergenic
947766774 2:232642950-232642972 ATGGATCATCTCATGGATGAGGG + Intronic
1168752389 20:291995-292017 CAGGATCTGCTGATGGATGTGGG - Intergenic
1169374544 20:5055903-5055925 CAGGATAATCAGTTGGATCTGGG + Intergenic
1169522017 20:6384486-6384508 CAGGATGAGCTCATGGAAGAGGG - Intergenic
1169932490 20:10849447-10849469 CAATGTAATCTGATGAATGAAGG + Intergenic
1170485740 20:16814338-16814360 CAGGATAATCTGATTGTCCAGGG + Intergenic
1173077181 20:39830340-39830362 CAGGACATTCTGAAGGGTGAAGG - Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1178005140 21:28210365-28210387 GAGGAGAACCAGATGGATGATGG - Intergenic
1179551273 21:42145535-42145557 GAAGAGAATCTGATGGAGGAGGG + Intergenic
1180058527 21:45373164-45373186 CAGGCTAGTCTGATGGGGGATGG - Intergenic
1182030149 22:27152611-27152633 CAGGAAAATTTGGTTGATGATGG - Intergenic
1182705156 22:32272351-32272373 CAGGAAAATCTTCTGGCTGATGG - Intergenic
1184093731 22:42305570-42305592 CAGGACAAATGGATGGATGAAGG + Intronic
1185157131 22:49199965-49199987 CATGATAATCACATAGATGAGGG - Intergenic
949459675 3:4276949-4276971 CAGGATGTTCTGAGGGAAGATGG + Intronic
950467924 3:13166462-13166484 CAGGAGACTCTGATGGCTCAGGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
954238164 3:49273034-49273056 CAAGATAATCAGTTGTATGAGGG + Intronic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
954957650 3:54536437-54536459 CAGGACAATCTCAAGGACGATGG + Intronic
955489498 3:59468287-59468309 AAGGATGATTTGGTGGATGAGGG + Intergenic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
956976346 3:74584900-74584922 GAGGATATTATGATGGAAGATGG - Intergenic
959952998 3:112202178-112202200 CAGAAAAAAATGATGGATGAGGG + Intronic
960025020 3:112998864-112998886 CAGGAATATCTGGTGGATTAAGG + Intronic
960556954 3:119040328-119040350 AAGGATAACTTGGTGGATGAGGG - Intronic
963181686 3:142363407-142363429 CAGGATAATTTGATGAAGAAGGG - Intronic
970266607 4:14295211-14295233 TAGGAAAATCAGATGAATGATGG - Intergenic
971834081 4:31738998-31739020 AAGGACAATGTGATGGATGGTGG + Intergenic
973157206 4:46970976-46970998 CAGGATAGCCTGATGTATTAGGG + Intronic
974490020 4:62552516-62552538 CAGGATAATCTGTTGTATATTGG - Intergenic
976985106 4:91284654-91284676 CATGATTATCTGACGGATGCTGG - Intronic
977030537 4:91876842-91876864 CAGGACACACTGATGGAAGAGGG - Intergenic
979659136 4:123232656-123232678 CAGGATAATGTGTTGAACGAGGG + Intronic
979849638 4:125560173-125560195 CAGGATAATCTGGTGGGTAGGGG - Intergenic
979964030 4:127055797-127055819 CAGGATCTTCTGTGGGATGAAGG - Intergenic
980182727 4:129421912-129421934 CAGCGAAATCTGATGGATGAAGG + Intergenic
980980270 4:139648926-139648948 CAGGAGAATCTCTTGAATGAGGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
986979029 5:13425234-13425256 CAGCATATGCTGATTGATGATGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987197556 5:15542415-15542437 TAGGAAAGTCTGATGGATGTTGG - Intronic
991611441 5:68453892-68453914 AAGGATAATTTGATGGGTAAGGG + Intergenic
995298032 5:110542423-110542445 CATGATAATCTGAAGCTTGATGG - Intronic
999019770 5:148152332-148152354 CAGGAAAATATGATGGAGGTGGG + Intergenic
1001063190 5:168512175-168512197 CATGATATTCTGATATATGAAGG + Intronic
1002328226 5:178423917-178423939 CTGGATTATCTGCTGGATTAGGG - Intronic
1003025157 6:2548225-2548247 AAGGATAGTTTGATGGGTGAGGG - Intergenic
1005797931 6:29387244-29387266 CTGGATAGGCTGATGCATGAAGG + Intronic
1006069979 6:31491188-31491210 AAGGATAATTTGGTGGATGGGGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1010270575 6:73911908-73911930 CAGGATAAGGTTATGGCTGAAGG - Intergenic
1011677768 6:89752031-89752053 AAGGATAATATTGTGGATGATGG + Intronic
1012201279 6:96409367-96409389 AAAGATAATTTGGTGGATGAGGG - Intergenic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1014397720 6:120946589-120946611 CACAATATTCTAATGGATGATGG - Intergenic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019614138 7:1951269-1951291 CAGGACCAGCTGGTGGATGAAGG + Intronic
1020170199 7:5839128-5839150 CAGAATGATCTGATGTCTGAAGG - Intergenic
1020790843 7:12626761-12626783 CAGCACAATATGGTGGATGATGG + Exonic
1021263818 7:18494382-18494404 CAGAACAATCCGATGGAAGAGGG - Intronic
1023039696 7:36161309-36161331 CAGGATGATGTGTGGGATGAGGG + Intronic
1026714420 7:72774829-72774851 CAGGAAAACATGATGAATGAGGG + Intronic
1028724132 7:94068239-94068261 AAGTATAATTTCATGGATGAAGG - Intergenic
1029269899 7:99370973-99370995 CAGGAGAATCTCTTGAATGAGGG - Intronic
1030246720 7:107390935-107390957 CAGGATAAAGTTATGGCTGAAGG + Intronic
1031634996 7:124091795-124091817 CAGGATAATCTGAAGGTGGGAGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033818486 7:145104448-145104470 CATGATAATTTGTTGAATGAAGG + Intergenic
1034539718 7:151749299-151749321 CAGGATAGGCTGATGGACGGGGG - Intronic
1034828917 7:154291970-154291992 CCAGTTAATCTGAAGGATGAGGG + Intronic
1035749143 8:1983474-1983496 CAAGATAACCCGACGGATGATGG - Intronic
1036927056 8:12917219-12917241 CAGAATAAACTGATTCATGAAGG + Intergenic
1038693734 8:29786290-29786312 CAGGATAATAGGCTGGAAGATGG - Intergenic
1039861028 8:41457823-41457845 CAGCATACACTGAAGGATGAAGG - Intergenic
1040647639 8:49418567-49418589 AAGGATAATCTGGTGGGTGCAGG - Intergenic
1041011335 8:53546986-53547008 CAGGGTAATTTTATGCATGAAGG - Intergenic
1043250725 8:78069836-78069858 AAGGATAATCTGGTGGGTGGGGG - Intergenic
1043467646 8:80528267-80528289 CAGGATTATTTGATGTATGTAGG + Intergenic
1048116107 8:131524937-131524959 TAAAATAATCTGATGGATGAAGG - Intergenic
1048194308 8:132319656-132319678 CCAGATGATGTGATGGATGATGG + Intronic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1050496560 9:6248487-6248509 GAGGATCATCTGATGGTGGAAGG - Intronic
1051776127 9:20636016-20636038 ATGGCTAATCTGATGGGTGAGGG + Intergenic
1052957720 9:34267070-34267092 CAGGAAAATCAGATAGTTGAGGG + Intronic
1058641487 9:107090049-107090071 AAGGATAATTTGCTGGATGTAGG - Intergenic
1059785016 9:117572119-117572141 AAGGATAATTTGGTGGATGAAGG - Intergenic
1060831456 9:126720218-126720240 CAGGATCCTCTGACAGATGAGGG + Intergenic
1187335143 X:18375183-18375205 CAGGATCATCTGAAGCTTGATGG + Intergenic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1190635051 X:52425106-52425128 CAGGATAAGCTGTTAGTTGATGG - Intergenic
1190654221 X:52597026-52597048 CAGGATAAGCTGTTAGCTGATGG + Intergenic
1193277024 X:79601724-79601746 CAGGATAAAGTTATGGTTGAAGG - Intergenic
1193925863 X:87483463-87483485 AAGGATCATCAGATGTATGAAGG + Intergenic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1194968400 X:100315932-100315954 CAGTTGAATATGATGGATGATGG + Intronic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1196649100 X:118150645-118150667 GAGGATAATTTGGTGGGTGAGGG - Intergenic
1197036015 X:121874182-121874204 CGGGATAATCTGATTGATTAAGG + Intergenic
1197860757 X:130967431-130967453 CATGATATTTTGATGGAGGAAGG + Intergenic
1198075152 X:133187057-133187079 GAGGAAAATCTACTGGATGAAGG + Intergenic
1198510352 X:137344218-137344240 GAGGATATTCTGATAAATGATGG + Intergenic
1200968086 Y:9119801-9119823 CAGGATAAGGTTATGGATGAAGG - Intergenic
1200976413 Y:9216413-9216435 CAGGATAAGGTTATGGCTGAAGG - Intergenic
1201747885 Y:17399483-17399505 CAGTATAATATGAGGGTTGAGGG - Intergenic
1201770304 Y:17612095-17612117 CAGGATTATCTGTTCAATGAGGG - Intergenic
1201831250 Y:18293892-18293914 CAGGATTATCTGTTCAATGAGGG + Intergenic
1202068601 Y:20967197-20967219 CAGGATAAAGTCATGGCTGAAGG + Intergenic
1202134755 Y:21650118-21650140 CAGGATAAGGTTATGGCTGAAGG + Intergenic
1202142658 Y:21744274-21744296 CAGGATAAGGTTATGGATGAAGG + Intergenic
1202144200 Y:21761344-21761366 CAGGATAAGGTTATGGATGAAGG - Intergenic
1202267248 Y:23033222-23033244 AGGGATACTCTGAAGGATGAAGG + Intergenic
1202420240 Y:24666966-24666988 AGGGATACTCTGAAGGATGAAGG + Intergenic
1202450546 Y:25003116-25003138 AGGGATACTCTGAAGGATGAAGG - Intergenic