ID: 1150917563

View in Genome Browser
Species Human (GRCh38)
Location 17:69451951-69451973
Sequence GTGGGTGGCAAGGAGGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 490}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150917553_1150917563 14 Left 1150917553 17:69451914-69451936 CCGCTGGCAGTCTGGAGAATGTA 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG 0: 1
1: 0
2: 3
3: 73
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150917563 Original CRISPR GTGGGTGGCAAGGAGGCTGT TGG Intronic
900609127 1:3537081-3537103 GTGGGAGCCAGAGAGGCTGTGGG + Intronic
900798446 1:4723493-4723515 GGAGGTGGCCAGGAGGCTGCAGG + Intronic
901163766 1:7199721-7199743 GTTGGTGGAAAGGAGGATGGTGG + Intronic
901187319 1:7383284-7383306 GTGGGTGTCAAGGAGCCTTAGGG - Intronic
901490792 1:9595335-9595357 GTGAGAGCCAAGGAGGCTGAGGG - Intronic
901926171 1:12567575-12567597 GTTGGTGGCCTGGAGGCTGGTGG + Intergenic
902315595 1:15616452-15616474 GTAGGTAGTAAGTAGGCTGTTGG - Intergenic
902810149 1:18883461-18883483 GAGGATGGACAGGAGGCTGTTGG - Intronic
903017191 1:20368855-20368877 GAGGGTGGATAGGAGGCTGGAGG + Intergenic
903464897 1:23545241-23545263 GGAGGTGGCAAGGAGGATTTTGG + Intergenic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
903816319 1:26066936-26066958 GAGGGTGTCAGGGAGGCAGTGGG - Intronic
903999919 1:27333065-27333087 GTGAGTGGCAGGGAAGCTGATGG - Intronic
904204096 1:28841367-28841389 GCAGGTGGCAAGGAGGCTGGGGG + Intronic
904290525 1:29482846-29482868 CTGGGTGGAAAAGAGGCTGCTGG - Intergenic
904482960 1:30805525-30805547 GGGGGTGGGAAGGGGGCTGCCGG + Intergenic
904696249 1:32333220-32333242 ATGGGTGGCAAGGTGGCTCCTGG - Exonic
904842070 1:33379314-33379336 GTGGGGGGCAGGGGGGCAGTGGG - Intronic
906199881 1:43953134-43953156 ATGGGCACCAAGGAGGCTGTGGG - Intronic
906262693 1:44406110-44406132 GTGTGTGGGGTGGAGGCTGTCGG - Intronic
907311470 1:53541381-53541403 GTGGGTGGCTGGGTGGGTGTGGG - Intronic
907515632 1:54991639-54991661 GTGGGTGGCGGGAAGGCTGAGGG + Intronic
909206085 1:72759512-72759534 GAGGGTGGCAGGGAGGCTCAGGG - Intergenic
911956385 1:104241036-104241058 GAGAGTGGCAGGGAGGCTATGGG + Intergenic
913453170 1:119006695-119006717 TGGGGAGGCAGGGAGGCTGTCGG + Intergenic
915468745 1:156113617-156113639 GTGGGGGGCAAGAAGGTAGTGGG - Intronic
915629048 1:157138043-157138065 GTGAATGGCAAGGAGGTTCTGGG - Intronic
915915672 1:159939136-159939158 GAGACTGGCAAGTAGGCTGTTGG - Intronic
917213691 1:172656768-172656790 GTGCCTGGTAAGGAGGCAGTAGG + Intergenic
918854504 1:189733679-189733701 ATGGGTGTGAAGGAGGCTGGGGG - Intergenic
919687181 1:200494886-200494908 CTGGGTGGCCTGGGGGCTGTGGG - Intergenic
919795985 1:201321913-201321935 GTGGTAGGCCAGGAGCCTGTCGG + Intronic
920067095 1:203276751-203276773 GTGGGTGGAGAAGAGGGTGTGGG + Intergenic
920202826 1:204270493-204270515 GTGGGTGGCTAGGTGGCTCATGG - Intronic
920373669 1:205494886-205494908 GGGGCTGGCAGGGAGGCAGTGGG + Intergenic
920533380 1:206721599-206721621 GGTGGTGGAAAGGAGGCTTTAGG + Intronic
920949361 1:210557885-210557907 GTGGGTGGCCAGGAGTATGTGGG + Intronic
922796010 1:228340249-228340271 GGGGGGTGCAGGGAGGCTGTGGG - Intronic
923925481 1:238622072-238622094 GTGGGAGGAAAGGAGGAGGTGGG + Intergenic
1062796942 10:351808-351830 GTTGGCGGCAAGGAGCCGGTGGG - Intronic
1063218911 10:3948367-3948389 GAGGGTGGAAGGGAGGCTGAGGG + Intergenic
1063589157 10:7378836-7378858 ATGGGTGGGTAGGAGGCTGTTGG + Intronic
1064006383 10:11702612-11702634 GTGGGTGGCAGGCAGGCAGCAGG - Intergenic
1065937277 10:30531868-30531890 CTGGGAGGCAAGAAGGCAGTAGG + Intergenic
1067463262 10:46474105-46474127 GTGGGAGGCAGGGAAGGTGTTGG - Intergenic
1067578248 10:47421089-47421111 GTGGGTGCCAAGGAGTGTGCAGG + Intergenic
1067623932 10:47910533-47910555 GTGGGAGGCAGGGAAGGTGTTGG + Intergenic
1067776165 10:49166263-49166285 TTGGGTGCCAAGGAGGCAGAGGG + Intronic
1068799877 10:61128184-61128206 GTGTTTTGCAAGGAGGCTGTGGG + Intergenic
1069629826 10:69890625-69890647 GTGGGTGGAAAGGGGGATGGTGG + Intronic
1069723438 10:70563512-70563534 GTGGGTGCAGGGGAGGCTGTGGG - Intronic
1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG + Intergenic
1069774422 10:70918494-70918516 CTGGGTGACAGAGAGGCTGTAGG + Intergenic
1069875973 10:71563071-71563093 GTGGGTGGGGAGGCAGCTGTTGG + Intronic
1070976494 10:80609690-80609712 GTGGGAGTCCAGGAGGCTGCAGG + Intronic
1071216208 10:83405069-83405091 CTGGGGGGCAAGGAGGATGTGGG - Intergenic
1071848359 10:89542856-89542878 AAGGGTGGATAGGAGGCTGTTGG - Intronic
1073515896 10:104075263-104075285 GAGGGTAGCAAGCAGGCAGTGGG - Intronic
1075241880 10:120786613-120786635 GTGGGAGGCAGAGATGCTGTAGG - Intergenic
1075413387 10:122245613-122245635 GGGTGTGGCAAGCAGGTTGTTGG + Intronic
1075480338 10:122775632-122775654 GTGTGTGGCAAGAAGGCAGATGG + Intergenic
1075926842 10:126258375-126258397 GTGTGGGGCACGGAGGCAGTGGG - Intronic
1076402554 10:130193536-130193558 GTGGGAGGGAAGGTGGCTGTGGG - Intergenic
1076590388 10:131578409-131578431 GTGTGGGGAAAGGAAGCTGTGGG - Intergenic
1076753298 10:132554538-132554560 GTGGGTGGCATGGGTGTTGTGGG + Intronic
1076753373 10:132554915-132554937 GTGGGTGGCATGGTTGGTGTGGG + Intronic
1076753411 10:132555092-132555114 GTGGGTGGCATGGCTGCTGTGGG + Intronic
1077118450 11:896006-896028 GTGGGAGGGCAGGAGGCAGTAGG - Intronic
1077479663 11:2807688-2807710 GTGGGTGGGGAGGAGGCTGAGGG - Intronic
1078361157 11:10668932-10668954 GTGGGAGGCAGTGAGACTGTGGG - Intronic
1079348053 11:19670173-19670195 GTGAGTGGCAAGGAGTATGCAGG - Intronic
1081763022 11:45590482-45590504 GTGGGTGGGGAGCAGGCTGTTGG - Intergenic
1083309195 11:61775860-61775882 GTGGGTGTGAAGTAGGGTGTGGG + Intronic
1083633701 11:64108946-64108968 GTGGGCAGGAAGGAGGCTGAGGG + Intronic
1083938718 11:65883653-65883675 GGGGCTGGCAAGGAGGCAGTTGG - Exonic
1084117280 11:67049715-67049737 GTGGTGGACAAGGAGGCTCTCGG + Exonic
1084175539 11:67420559-67420581 GTGGGGGGCAGGGAGTGTGTGGG + Intronic
1084425811 11:69084058-69084080 GTGGGAGGCTGGGAGGCTGGCGG + Intronic
1084954552 11:72684434-72684456 GCGGGTGGTAATGAGGCTCTAGG + Intergenic
1089104641 11:115992264-115992286 GTGGGAGGCATGCAGGTTGTTGG - Intergenic
1089169190 11:116500491-116500513 GAAGGTGGCCGGGAGGCTGTGGG - Intergenic
1089196409 11:116696257-116696279 GTGGGAGGGAGGGAGACTGTGGG - Intergenic
1089777780 11:120850674-120850696 GTGGCTAGCAGGGAGGCTGGTGG + Intronic
1090603456 11:128396251-128396273 CAGGGTGGCAATGAGGCTGGGGG - Intergenic
1090866939 11:130709625-130709647 GGTGGTGGCAAGGAGTCTGCAGG + Intronic
1090917545 11:131178917-131178939 GTGGGTGGAAAGTAGGAAGTTGG + Intergenic
1091301580 11:134511184-134511206 GTGGCCGGCAAGGATGCTGTGGG + Intergenic
1091899719 12:4135042-4135064 GTTGGGGGCACGGAGGTTGTGGG - Intergenic
1091996636 12:4999014-4999036 TTGGGTGGCAAGGGGGAAGTGGG - Intergenic
1092105973 12:5922049-5922071 GTGGCTGGAGAGGAGGATGTGGG - Intronic
1092148756 12:6232750-6232772 GTGGGAGTCAGGGTGGCTGTGGG - Intronic
1092478976 12:8843231-8843253 GTGGATGCCAAGGAAGCTGCGGG - Exonic
1092525208 12:9305572-9305594 GTTGGTGGCAAGGAGGCTCCAGG + Intergenic
1092542063 12:9426245-9426267 GTTGGTGGCAAGGAGGCTCCAGG - Intergenic
1092799571 12:12150944-12150966 GTGGATGGGAAGGATGATGTCGG + Exonic
1094132919 12:27094223-27094245 CTTGGTGGCATGGAGGGTGTGGG + Intergenic
1094510945 12:31096194-31096216 GTTGGTGGCAAGGAGGCTCCAGG + Intronic
1095159938 12:38904963-38904985 GTGGGTGGGGAGGAAGCTGCCGG + Intronic
1095977610 12:47950346-47950368 GTCAGTGGCAAGGAGGCAGCAGG + Intergenic
1096449803 12:51728912-51728934 GTGGCTTGAATGGAGGCTGTTGG - Intronic
1096466310 12:51848979-51849001 GAGGGTGGCAAGGAGGGGCTGGG - Intergenic
1096968084 12:55644484-55644506 GTGGTTGGCTAGGATGCTGCAGG - Intergenic
1097917796 12:65038987-65039009 GTGGGTGGCAGGGTATCTGTCGG + Intergenic
1097929730 12:65170184-65170206 GTGGGGGGCCAGGAGGCCGGCGG + Exonic
1098343608 12:69476723-69476745 TTGGGTGGGCAGGCGGCTGTGGG + Intronic
1100394094 12:94169734-94169756 GTGGGTGGTAAGTGGGCTGGAGG - Intronic
1100962932 12:99984255-99984277 GAGGGGGGCAAGGACTCTGTGGG - Intronic
1101445971 12:104737219-104737241 GGGGATGGCAAGGAGCCTGCAGG - Intronic
1102147592 12:110666614-110666636 GAGTGTGGCGAGGAGGCTGTGGG - Intronic
1102260084 12:111438179-111438201 GTGGGCGGGAAGGCGGCTGGAGG + Intronic
1102589584 12:113947297-113947319 TGGGCTGGCCAGGAGGCTGTGGG - Intronic
1102872705 12:116426490-116426512 GCTGGGGGCAAGGAGGCTGAGGG + Intergenic
1103278279 12:119732429-119732451 GTGGGAGGGAAGGGGTCTGTGGG + Intronic
1103995531 12:124827633-124827655 CAGGATAGCAAGGAGGCTGTGGG - Intronic
1104019050 12:124979760-124979782 TCTGGTGGCAAGGAGGGTGTGGG - Intronic
1104177042 12:126342951-126342973 GTGGGTGGGATGGAGGATGCAGG + Intergenic
1104344155 12:127980788-127980810 GGGGGTGGGAAGGAGACAGTAGG - Intergenic
1104513845 12:129405495-129405517 CTGTGGGGCAAGCAGGCTGTGGG + Intronic
1104637154 12:130445044-130445066 CTGGGTGGCCAGGAGTATGTTGG + Intronic
1104841805 12:131829206-131829228 GTGGAGGGGAAGGAGGCTGAGGG - Intronic
1105273888 13:18903791-18903813 GAGGGTGGCAAGGAGGAGGGGGG - Intergenic
1105617777 13:22035657-22035679 CTGGGTGGGAAGGAAGCTGGTGG - Intergenic
1105806734 13:23955810-23955832 GAGGGTGGCAAGGAGGAGGGGGG + Intergenic
1106435901 13:29722560-29722582 GTGGGTTGCAGGAGGGCTGTGGG - Intergenic
1107006730 13:35620443-35620465 GTGGTTGGCAAGGAGGCCAGTGG + Intronic
1107977484 13:45704122-45704144 GTGGGTGTGAAGGAGGGGGTAGG + Intronic
1109883004 13:68506767-68506789 GCGGGGGCCAAGCAGGCTGTAGG - Intergenic
1110279133 13:73672335-73672357 GTGGGTGGCAGGGAGGGAGTAGG - Intergenic
1113650653 13:112032023-112032045 GCTGGTGTCAAGGAGGCTCTAGG - Intergenic
1113789561 13:113020658-113020680 GTGGGAGGGGAGGAGGCCGTGGG - Intronic
1116032706 14:39591831-39591853 GTGGGTGGGAATGAGGGTTTTGG + Intergenic
1116946217 14:50837579-50837601 GTGGGTGGGATGGAGGATGGAGG - Intergenic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117463325 14:55968266-55968288 GTGGGTGGCAAAGGGGGTGTAGG - Intergenic
1117557446 14:56900438-56900460 TTGTGTGGGAAGGAGGGTGTTGG - Intergenic
1117986007 14:61386747-61386769 GTGGGAGGCAGGGAGGCAGACGG + Intronic
1118664272 14:68049722-68049744 AAGGCTGGCAAGGAGGCTGTGGG - Intronic
1118772826 14:68953345-68953367 GTGGGGGACATGGAGGCTGAGGG - Intronic
1118869373 14:69728181-69728203 GTGGTTGGAAGGGAGGGTGTGGG + Intronic
1118874305 14:69769947-69769969 GTGGGTGGCGAAGAGCCAGTCGG + Intronic
1119996594 14:79260645-79260667 GTGGGTGGCAAGTGGGGTGGTGG - Intronic
1120711415 14:87797299-87797321 GTGGGAGGAAAGGAGGATGCTGG + Intergenic
1120955123 14:90075330-90075352 CTGGGAGGCATGGAGGCTGGAGG - Intronic
1121568155 14:94925992-94926014 GTGTGTGTCTATGAGGCTGTTGG + Intergenic
1121624377 14:95373632-95373654 GTGAGGGGCAAGGTGGCTGAGGG - Intergenic
1121965570 14:98301068-98301090 GAAGTTGGCAAGGAGGCAGTGGG + Intergenic
1122625902 14:103085244-103085266 GTGGCTGGCATGCAGGCAGTAGG - Intergenic
1122784124 14:104156047-104156069 GTGGGTGCCACGCTGGCTGTGGG + Intronic
1122791098 14:104184517-104184539 GTTGGTGGCAGGGAGGCTGGTGG + Intergenic
1124047560 15:26164141-26164163 GTGGGTGGCAAGGAAGGTGGTGG + Intergenic
1124375377 15:29126091-29126113 GTGGGTGGGGAGCAGCCTGTGGG - Intronic
1125420208 15:39497522-39497544 ATGGATGGCAGGGAAGCTGTTGG + Intergenic
1126686994 15:51257061-51257083 GTGAGTGGCAAGGGTGCTTTAGG + Intronic
1128497125 15:68205017-68205039 GTGGGAAGGAAGGTGGCTGTGGG - Intronic
1128648377 15:69393364-69393386 GTGGGTAGAGAGGAGGGTGTGGG + Intronic
1129007200 15:72383836-72383858 GACAGTGGAAAGGAGGCTGTGGG + Intergenic
1129272865 15:74428656-74428678 GTGGGAGTCTAGGAGGCAGTGGG + Intronic
1129530475 15:76260708-76260730 GTGGATGGCATGGAGGTTTTGGG + Intronic
1130056716 15:80532606-80532628 GTGAGTGGCCAGCATGCTGTTGG + Intronic
1131106787 15:89740315-89740337 GTGGGTCGCTGGGAGGCTCTCGG + Intronic
1132406500 15:101544371-101544393 GTGGGTGGAAAGGAGTCTGAAGG + Intergenic
1132611862 16:821068-821090 GTGGTGGTGAAGGAGGCTGTTGG - Intergenic
1132720427 16:1312977-1312999 GAGGGTGGCATTGAGGCTGCTGG + Intronic
1133109249 16:3535983-3536005 CAGAGTGGCAAGCAGGCTGTGGG - Intronic
1133649755 16:7800653-7800675 GTGAGTGGAAAAGAGGCTGGTGG - Intergenic
1134242608 16:12517149-12517171 GTGGGTGGCAAGGACTCATTAGG + Intronic
1136348855 16:29694486-29694508 GTGGGGGGAAGGGAGGTTGTGGG - Intronic
1137520714 16:49193100-49193122 GTGACTGGAAAGGAGCCTGTGGG + Intergenic
1138210336 16:55157823-55157845 GTGGGTGACATGGGGGCTGCAGG - Intergenic
1138514588 16:57529056-57529078 GTGGGCGGCAAGGAGTCGGCAGG + Exonic
1139295501 16:65897030-65897052 GTGGGTGCCCCGGAAGCTGTGGG - Intergenic
1139358083 16:66379441-66379463 GTGGGTGGGCAGCAGGCTGTGGG - Exonic
1139508235 16:67410292-67410314 GTGGGCAGCAAGGAGCTTGTGGG - Intronic
1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG + Exonic
1139922481 16:70468883-70468905 GTGGGTGGCTAGGAGGCGCTCGG - Exonic
1140364150 16:74368362-74368384 GAGGGTGGCAAAGAGGCCGCGGG - Intergenic
1141118718 16:81334255-81334277 GTTGGGGGAAGGGAGGCTGTCGG + Intronic
1141467286 16:84214733-84214755 GTGGATGACAAGGAGGCCATAGG + Intergenic
1141598125 16:85109875-85109897 GTCAGGGGCAAGGAGGCTGCAGG - Intronic
1141782594 16:86173797-86173819 GGGGGTGGAAAGGAGGCTTGTGG + Intergenic
1142067826 16:88072842-88072864 GCAGGTGGCACGGAGGCTGCGGG - Intronic
1142173290 16:88633937-88633959 GTGGGTGGAAGCGTGGCTGTGGG - Intergenic
1142250298 16:88988928-88988950 GTGGGTGGGAAGGAGACTGCTGG - Intergenic
1142279037 16:89138172-89138194 GTGGGAGGCTGAGAGGCTGTGGG - Intronic
1142304332 16:89277189-89277211 GTCGGTGGCAGGGATTCTGTGGG + Intronic
1142313642 16:89329210-89329232 GTGGCTGTCGAGGAGGCTCTAGG + Intronic
1142469569 17:155862-155884 GGGGGTAGCCAGGAGGCTGGGGG - Intronic
1142964745 17:3573508-3573530 GTGTGTGGCCAGGAGGGTATGGG - Intronic
1143254422 17:5544962-5544984 GTGAGGGGGAAGGAGGCTGAAGG + Intronic
1143404436 17:6667812-6667834 GGGGGTGGGAAGGAAGCAGTGGG + Intergenic
1143474886 17:7196836-7196858 GTGGGTGGCGAGGACGGTGAAGG - Exonic
1143618875 17:8069792-8069814 GTGTTTGGGAAGGAGGCTGGGGG - Intergenic
1144314339 17:14045846-14045868 GTGGGTGGGATGGGGGCTGGGGG + Intergenic
1144359928 17:14482252-14482274 GTGGTTGGCTAGGAGTTTGTTGG + Intergenic
1144662133 17:17077971-17077993 GTGGGTGGTTAGGAGGATCTGGG - Intronic
1144681983 17:17202311-17202333 GTGAGGGACAAGGAGACTGTAGG + Exonic
1144826431 17:18108101-18108123 TTGTGTGGCAAGGAGACTGCAGG + Intergenic
1146060993 17:29607371-29607393 TGGGGTGGCAAAGAGGCTGTTGG - Intronic
1146229417 17:31095098-31095120 GGCGTTGGCAAGGAGGCTGGGGG - Exonic
1146704589 17:34991732-34991754 CTGGATGGTAAGGAGGCTCTTGG - Exonic
1147453220 17:40519083-40519105 GTGGTTGGCAACAAGCCTGTGGG - Intergenic
1147586357 17:41655765-41655787 GTGGGTGGCAGGGAAGGTGGAGG + Intergenic
1147643803 17:42021602-42021624 GTGTGTGGCCAGGCGTCTGTGGG + Exonic
1147965138 17:44190652-44190674 GAGGGGGCCAAGGAGGCTGAGGG - Exonic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1148343734 17:46889675-46889697 GTCTGTGGCAAGGAGGGTGAGGG - Intergenic
1148456332 17:47813406-47813428 GTGGGGGGCAAGGAAGGTGCAGG + Intronic
1148698144 17:49573380-49573402 GTGGGGGGCAGGGAGACTGAAGG - Intergenic
1148700350 17:49583070-49583092 GTGGGTGGCAGGGATCCTGGGGG + Intronic
1148871848 17:50663070-50663092 GTGAGTGGCAAGGAGTTTGTGGG + Intronic
1148950104 17:51303295-51303317 GTGTGTGGGAAGGGGGGTGTTGG - Intergenic
1148953565 17:51335377-51335399 GTGTGTGGCAGGGAGGGTGGTGG + Intergenic
1149032469 17:52099611-52099633 GTTGGTGGCAAGCTGACTGTTGG + Intronic
1150263199 17:63813550-63813572 TTGGGTGGCTAGGAGGATGTGGG + Intronic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151679058 17:75614410-75614432 GAGTGTGGCAGGGTGGCTGTGGG - Intergenic
1151719369 17:75846709-75846731 GTGGGAGGCAGGGAGGCAGGAGG + Exonic
1151758287 17:76087120-76087142 TTTGGGGGCAAGGAGCCTGTGGG - Intronic
1151826832 17:76528475-76528497 CTGGGTGCCAAGGAAGCTGGAGG - Exonic
1151974439 17:77476372-77476394 GTGGCTGGGACGGGGGCTGTAGG - Intronic
1152071118 17:78134119-78134141 GTGTGTGGGAGGGAGCCTGTGGG + Intronic
1152293087 17:79451912-79451934 CTGGGTGGCAGGGATGCTGTGGG - Intronic
1152301351 17:79496825-79496847 GTGGGAGGCAGGCAGGCTTTCGG - Intronic
1152581287 17:81166483-81166505 GAGGGGGGCACGGAGGCTGGCGG + Intergenic
1152584747 17:81183870-81183892 GCTGGTGGCACGGAGGGTGTTGG + Intergenic
1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG + Intronic
1152754397 17:82081135-82081157 GTGGGTGGCCAGGCGGGAGTGGG - Intronic
1152799488 17:82324180-82324202 GGGGGTGGCAGGGAGGCGGGGGG + Intronic
1152831123 17:82497486-82497508 GTGGGTGGGAGGGAGGCCGGCGG - Intergenic
1152934011 17:83125468-83125490 GCAGGTGGGAAGGAGGCTGCAGG - Intergenic
1152937998 17:83151916-83151938 GCGGGTGGCAGGGAGACAGTGGG + Intergenic
1155656711 18:28201360-28201382 AAGGGTGGCAAGCAGGGTGTGGG - Intergenic
1156488392 18:37481295-37481317 GTAGGAGGCAAGGAAGCAGTGGG - Intronic
1156496549 18:37529527-37529549 GTGGGTGGAACAGAGGCTGGGGG + Intronic
1156527366 18:37779289-37779311 GTGGGTGGGAAGGAGACTAAGGG - Intergenic
1157300275 18:46474206-46474228 ATGGGTGGCAAGGAGACTTCAGG + Intergenic
1157593737 18:48851342-48851364 GTGGAAGGCACGCAGGCTGTGGG + Intronic
1159123496 18:64196761-64196783 CTGGGTGGAGAGGAGGCGGTAGG + Intergenic
1160596092 18:79975472-79975494 GTGAGGGGCAAGGAGGCTGCAGG - Intronic
1160828295 19:1090830-1090852 GTGGGTGGCCAGGAAGATGTGGG - Intronic
1160858575 19:1228126-1228148 CTGGGTGGCAGGGGGGCTGTGGG + Exonic
1160918226 19:1507648-1507670 GTGGGAGGGTAGGAGGGTGTTGG + Intronic
1161483905 19:4524677-4524699 GTGGGGGGAAAGGGGGGTGTTGG - Intronic
1162308379 19:9889648-9889670 GTGAGTGGAAGGGAGGCAGTGGG + Intronic
1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG + Intronic
1162477285 19:10908182-10908204 GTGAGTGGCAGGGGGGCTGCCGG - Intronic
1162534090 19:11253064-11253086 GTGGGAGCCATGGAGGGTGTTGG + Intronic
1162756668 19:12865039-12865061 GGAGGTGATAAGGAGGCTGTAGG - Exonic
1163054243 19:14706375-14706397 GTGGATGGCCAGGAGGTTGAGGG - Intronic
1163234022 19:16020681-16020703 GTGGGTGGTCAGCAGGCTGTGGG + Intergenic
1163323467 19:16587977-16587999 GTGGGAGGGAAGGACGCTGTGGG - Intronic
1163446785 19:17351676-17351698 CTGGGAGGCCAGGAGGCTGGAGG + Exonic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163614543 19:18318880-18318902 GTGACAGGCAAGGAGGCCGTGGG - Intronic
1164437448 19:28243284-28243306 GTGGGTGGCCAGGAGGGTTGAGG - Intergenic
1164577344 19:29413270-29413292 CGGGTTGGCAAGGTGGCTGTGGG - Intergenic
1164578595 19:29420604-29420626 GTGGGTGGAGAGGAGGCCGGGGG - Intergenic
1164578624 19:29420751-29420773 GTGGGTGGAGAGGAGGCCGGGGG - Intergenic
1164578635 19:29420800-29420822 GTGGGTGGAGAGGAGGCCGGGGG - Intergenic
1164578645 19:29420837-29420859 GTGGGTGGAGAGGAGGCTGGGGG - Intergenic
1164866930 19:31612352-31612374 CTTGGTGGCAAAGAGGCTGCAGG - Intergenic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1165739482 19:38196770-38196792 GGGGGGAGCAAGGAGGCTGAGGG + Intronic
1165748615 19:38246333-38246355 GTGGGAGGCAAGGAGCCAGCTGG + Intronic
1165808670 19:38597173-38597195 GTGGGTGGCGAGGAGGATAGAGG - Intronic
1165827724 19:38714754-38714776 CTGGCTGGCAAGGTGGCTGCCGG - Intronic
1165855634 19:38878113-38878135 GTGGCAGGAGAGGAGGCTGTGGG + Intronic
1165918376 19:39275750-39275772 GTAGGTGGGAAAGAGGGTGTGGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166698862 19:44870302-44870324 GAGGGCGGCCAGGAGGATGTGGG + Intronic
1166730940 19:45058788-45058810 GTGGGTGGCAGGCAGGGTGTGGG - Intronic
1166803846 19:45473386-45473408 GGGGGTGGGAGGTAGGCTGTGGG + Exonic
1166817920 19:45557952-45557974 GCAGGTGGGAAGGAGGCTGGAGG - Intronic
1166873419 19:45883973-45883995 GTGGGTGGCAAAGGGGCAGAGGG + Exonic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1167538774 19:50072312-50072334 GGGGATGGTAAGGAGGGTGTAGG + Intergenic
1167780378 19:51594954-51594976 GGGGGTGCTCAGGAGGCTGTGGG + Intergenic
925017615 2:543722-543744 GTGGGAGGCAGGGAGGCTGGAGG + Intergenic
925017686 2:543921-543943 ATGGGAGGCAGGGAGGCTGGAGG + Intergenic
925294845 2:2769549-2769571 CAGGGTGGCAAGGAGGGTGACGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
925422646 2:3725143-3725165 GTGGGTGTGAAGTAGGCAGTAGG + Intronic
925621201 2:5794434-5794456 GTGGAAGGCAAGGAGGCTTCGGG + Intergenic
925969643 2:9097234-9097256 CTGGGTGGCAGGGAGGCAGGGGG + Intergenic
926121440 2:10243296-10243318 GTGGGTGCCATTTAGGCTGTGGG - Intergenic
926166034 2:10522574-10522596 GGGGGTGCTGAGGAGGCTGTGGG - Intergenic
927040148 2:19221354-19221376 GTTGTTGGCAAGGAGGGGGTTGG + Intergenic
927753549 2:25690714-25690736 AAGGGTGGCAAGGAGGTTGTTGG + Intergenic
927846692 2:26475977-26475999 GTCGGCGGCAAAGAGGCTGCGGG + Exonic
928231783 2:29504918-29504940 GGGGGAGGCAAGGAGCCTGGAGG + Intronic
929484097 2:42339504-42339526 GGGGGTTTCAAGGAGGTTGTCGG - Intronic
929799081 2:45084005-45084027 GAGGGTGGCATGGGTGCTGTTGG - Intergenic
929927978 2:46230928-46230950 GCGGGTGGGATGGAGGCTGGGGG + Intergenic
931842922 2:66173445-66173467 GTGGGAGGGAAGGGGGCAGTAGG + Intergenic
932625578 2:73293373-73293395 GCGGGTGGCGGGGAGGCTGGCGG + Exonic
933113853 2:78441102-78441124 GTAGGTGGCAGGAAGGATGTGGG + Intergenic
934066047 2:88343006-88343028 GTGGGAGGCTGGGAGGCTGAAGG - Intergenic
934478000 2:94605679-94605701 GTGGGAGGCTTGGAGGCAGTGGG + Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
936341153 2:111633700-111633722 GTGGATGGCAATGAGGCAGAGGG + Intergenic
937094733 2:119228159-119228181 TGGGGTGGCCAGTAGGCTGTGGG + Intronic
937877124 2:126834202-126834224 GTTGGTGGTAATGATGCTGTTGG - Intergenic
937888125 2:126914429-126914451 GTGCCTCGCAAGGAAGCTGTGGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
939394415 2:141610465-141610487 GAGAGTGGCAAGGGGGCTGTAGG - Intronic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
939996023 2:148920877-148920899 GTGGGAGAAAAGGAGGCTCTTGG + Intronic
940398967 2:153224336-153224358 GGGGGTGGGGAGGAGGCTGTGGG + Intergenic
940660881 2:156543797-156543819 GTGGTGGGCATTGAGGCTGTTGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941211255 2:162642809-162642831 GTGGATAGCCAGGAGGCTGGAGG + Intronic
946163515 2:217849870-217849892 GGTGGTGGCAGGGAGGCTGAAGG + Intronic
946239595 2:218345504-218345526 GGGTGGGGCAGGGAGGCTGTGGG - Exonic
946427927 2:219609229-219609251 GTGGGGGCCCAGGAGGCTGTGGG + Intronic
946610548 2:221453386-221453408 GTGGGAAGCAAGGAGCATGTGGG - Intronic
946662808 2:222019276-222019298 ATGGATGGCCAGGAGGCTGAGGG + Intergenic
947517982 2:230823637-230823659 GCGGGTGTCAAGGACGATGTGGG - Intergenic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
1169924152 20:10765664-10765686 TTGGGTGGCTAGGAGGGTGATGG + Intergenic
1170557297 20:17525175-17525197 GTGGCTGGGAATAAGGCTGTAGG - Intronic
1170854609 20:20039449-20039471 GTACGTGGAAAGGTGGCTGTGGG - Intronic
1171017127 20:21552334-21552356 GTGGATGAGAAGGAAGCTGTGGG + Intergenic
1171298770 20:24041376-24041398 GGGGGTAGCCAGGAGGCTGGAGG - Intergenic
1171823978 20:29878167-29878189 GGTGCTGGCAAGGAGGCTGACGG + Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1171896094 20:30812168-30812190 GGTGCTGGCAAGGAGGCTGATGG - Intergenic
1172114006 20:32563118-32563140 GTGGAGGGCAGGGAGGCTGGAGG + Intronic
1172228301 20:33319974-33319996 GTGAGAGGCATGGAGGATGTTGG - Intergenic
1172437314 20:34938580-34938602 GTGTGTGGGAGGGAGGCAGTTGG + Intronic
1173712926 20:45176210-45176232 GTTGGTGGGAGGGAGGTTGTGGG + Intronic
1174313833 20:49681572-49681594 GGAGATGGCAGGGAGGCTGTTGG - Intronic
1174439739 20:50540975-50540997 CTAGTTTGCAAGGAGGCTGTGGG + Intronic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1174869668 20:54171407-54171429 TTTGGTGGGGAGGAGGCTGTAGG + Intronic
1175186065 20:57180312-57180334 GGGAGTGGGGAGGAGGCTGTGGG - Intronic
1175228223 20:57457560-57457582 GTGAGTGGCAAGGAGACAGGAGG - Intergenic
1175912967 20:62413428-62413450 GTGGGTGGGGAGGCGGCTGTGGG + Exonic
1175922269 20:62455799-62455821 GTGGGAGGCACGGAGGCTCCTGG + Intergenic
1176044708 20:63086586-63086608 GTCGGAGGCAAGGGGGCTCTCGG - Intergenic
1176240925 20:64075510-64075532 GGGGGTGGCCAGGGGGCAGTCGG - Intronic
1176258409 20:64166066-64166088 CGGGGTGGCAGGGAGGCTGGGGG - Intronic
1178149778 21:29781277-29781299 GTGGGAGGGAAGGAGGTTTTAGG - Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179908073 21:44434410-44434432 GACGGTGGCAGGGATGCTGTCGG + Intronic
1180875677 22:19174233-19174255 TGGGGTGGCAAGCAGGCAGTGGG - Intergenic
1181119848 22:20658360-20658382 GAGGGTGGCAAGCAGGCTAGGGG + Intergenic
1181182766 22:21079116-21079138 GTGTGTGGCAGCCAGGCTGTGGG + Intergenic
1181738635 22:24902001-24902023 GTGGGTGGGATGGGGGATGTAGG + Intronic
1181766282 22:25094457-25094479 GTGGGAGGCAAGCAGGCCCTGGG + Intronic
1182045505 22:27270985-27271007 GGGGGAGGCAGGCAGGCTGTTGG - Intergenic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1182714131 22:32341345-32341367 GTGAGGGGCCAGGAGCCTGTGGG + Intergenic
1183395857 22:37570424-37570446 GAGGGTGTCAAGGAGGCAGGAGG + Intronic
1183701543 22:39453990-39454012 CTGCCTGACAAGGAGGCTGTGGG - Intergenic
1183931812 22:41239760-41239782 GTGGGGGGCAGGGAGGCTCAGGG - Intronic
1184242135 22:43216893-43216915 GGGGGTGGGAGGGAAGCTGTTGG - Intronic
1184320660 22:43739964-43739986 GGGGGTGGCCAGGAGCCAGTCGG - Intronic
1184428998 22:44430292-44430314 GTGGGTGGGGAGCAGGGTGTGGG + Intergenic
1184532749 22:45066765-45066787 GTGGGCGGCAGGGAAGGTGTTGG + Intergenic
1184696684 22:46143340-46143362 GTGGGTGGCAAGGACTGAGTTGG - Intergenic
1185083256 22:48721299-48721321 GTGGGTGGCATGAAGGCAGTGGG - Intronic
1185088275 22:48752445-48752467 GTGGGCAGCAAGGAGGCTCTGGG - Intronic
1185280512 22:49967878-49967900 GTGGGTGCCGGGCAGGCTGTGGG + Intergenic
1185343500 22:50301693-50301715 GGGGGTGAGAAGGGGGCTGTGGG - Intronic
1185407586 22:50663251-50663273 CTGGGTGGAAAGGAGACTGGAGG + Intergenic
950553775 3:13682898-13682920 GTGTGTGACAAGGAGGTTGGTGG - Intergenic
950716435 3:14850798-14850820 GTGGGTGGGAGGGATGGTGTTGG + Intronic
952758188 3:36890593-36890615 GTTGGTGGCAAAGAGGATCTGGG + Intronic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
952882362 3:37992730-37992752 GTGGGAGCGGAGGAGGCTGTGGG - Intronic
952969691 3:38643179-38643201 GTGGGGTACAAGGAGGCTGAGGG - Intronic
953108399 3:39908392-39908414 GGAGGTGGCAAGGAAGATGTGGG - Intronic
953662911 3:44903992-44904014 GTGGGTGGCAGGAAGGCGCTGGG + Intronic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
953904376 3:46861149-46861171 GAGGGGGGCAAGGAGGCAGGAGG - Intronic
954425265 3:50439783-50439805 GTGGGTGGCTAGGGGGCTTGTGG + Intronic
955201954 3:56859503-56859525 GGGGGTGGCAAGAGGGATGTGGG - Intronic
956685649 3:71825026-71825048 GTGTGTGGCATGGGGGCTGGGGG + Intergenic
956738267 3:72255661-72255683 GTGGGTGGGTGGGGGGCTGTAGG - Intergenic
957835923 3:85589145-85589167 GTGTGTGGGGAGGAGGCTGGGGG + Intronic
958464709 3:94443242-94443264 GGGGGTGGCAAGGCAGCTGGGGG - Intergenic
959856316 3:111162772-111162794 ATGGCTTTCAAGGAGGCTGTTGG - Intronic
961091626 3:124117737-124117759 GTGGTGGCCAAGAAGGCTGTTGG + Intronic
962902358 3:139772434-139772456 GTGGGTAGGAAGGAGGGTCTGGG + Intergenic
963028535 3:140942730-140942752 GTGGGTGGTAAGGGGGCTACGGG + Intronic
964290024 3:155168015-155168037 GTGGTTGGCAAGGAAGCTGTAGG + Intronic
964650861 3:159009687-159009709 GTGCGAGGGAAGGAGGCTGATGG - Intronic
964907839 3:161740002-161740024 GTGGGTGGTATTGATGCTGTTGG - Intergenic
965079808 3:164021346-164021368 TGGGGTGGCAAGGAGGATGGGGG + Intergenic
966748877 3:183303409-183303431 GTGGCTGGCAAGGGGGCTCATGG - Intronic
966881616 3:184354068-184354090 CTGGGTGCCAAGGGGGCTGTGGG - Intronic
966885899 3:184378052-184378074 GTGAGTGGCCAGCAGGGTGTGGG - Intronic
967390201 3:188947800-188947822 GGGGGTGGGGAGGAGGCTGCAGG - Intronic
968460899 4:724240-724262 GTGGGTGACAAGGAGGCTCAGGG + Intronic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
968915544 4:3495623-3495645 GTGGGTGGCCAACAGGCTGGGGG + Intronic
969059956 4:4426565-4426587 CTGGGTGGGAAGGAGGCTGCTGG - Intronic
969265139 4:6059549-6059571 GAGGGTGCCAAGGAGGGTGTGGG - Intronic
969292860 4:6251918-6251940 GTCTGTGTCAAGGAGGCTCTGGG + Intergenic
969352601 4:6606370-6606392 GTGGCTGGCAAGGGGGGAGTTGG + Intronic
969538463 4:7770930-7770952 GAGAGTGGCAGTGAGGCTGTAGG - Intronic
969603457 4:8190165-8190187 GTGGGTAGCAGGGAGTCTGCAGG + Intronic
969651295 4:8469770-8469792 GTGGGCGGGAGGGAGGCAGTGGG - Intronic
970132358 4:12885653-12885675 GTGGGTGGGGAGGGGGCTGTCGG - Intergenic
972111822 4:35571363-35571385 GAGGCTGGCAAGGAGGCAATGGG + Intergenic
972367250 4:38387718-38387740 GTGGGTGGAAGGGTGGCTGGAGG + Intergenic
972512242 4:39779048-39779070 GTGTGTGGCAAGGCGGGGGTGGG - Exonic
972770072 4:42189511-42189533 TGGGGTGACTAGGAGGCTGTTGG - Intergenic
972981504 4:44709232-44709254 GTGGAGGGAAAGGAGGCTGCTGG + Intronic
973895649 4:55410068-55410090 GTGGGAGGCAAGGAGGAGGGAGG - Intronic
975760295 4:77613473-77613495 GTGGGTGGCGTGAAGGCAGTGGG + Intergenic
976770287 4:88644970-88644992 GTGGGAGGCAGGGAGACTCTAGG + Intronic
977237094 4:94521331-94521353 GTGGAAGGCAAGTAGGCTATAGG + Intronic
978255569 4:106688819-106688841 GTGGGGCTCAAGGAAGCTGTTGG + Intergenic
980236980 4:130120902-130120924 GTGGGTGGGAAGGAAGGTGGAGG + Intergenic
982200336 4:152954114-152954136 GTGGGTGGGAAGGAGGGTGGAGG + Intronic
985662548 5:1164331-1164353 GTGGGTGGGAAGGATGGTGTGGG + Intergenic
985831161 5:2232387-2232409 GTGAGTGTCAAGGAGGTTATAGG + Intergenic
985912078 5:2892585-2892607 GTGGGGCCCAAGGATGCTGTAGG - Intergenic
985943165 5:3155226-3155248 GGGGCTGGGAAGGAGACTGTGGG + Intergenic
986091961 5:4517603-4517625 GTGTGCTGCAAGGAGTCTGTGGG - Intergenic
986195769 5:5535397-5535419 GTGGGAGGCAGGGAGGCTAGGGG + Intergenic
986702365 5:10423161-10423183 GTGGTGGGGAAGGGGGCTGTGGG + Intronic
986731460 5:10637718-10637740 GTGGGGGGCAGGGACGCTGCGGG - Intronic
987033752 5:13999368-13999390 GGTGGTGGCCAGGAGGCTGGGGG - Intergenic
987075679 5:14379944-14379966 GTGGGTGGCCAGCAGGCGGGAGG - Intronic
989177604 5:38544111-38544133 GGGGGTGGCAATGAGGATGATGG - Intronic
989781155 5:45266036-45266058 GAGGGTGGCAAAGAGGGTTTAGG + Intronic
989828402 5:45886825-45886847 CAAGGTGGCAAGGAGGCTGGGGG - Intergenic
990368606 5:55094577-55094599 GTGGGGGGCAAGGAGTATGGAGG - Intergenic
992417023 5:76561522-76561544 CTGGGTGGCAGGGAGGCTGGGGG + Intronic
992826489 5:80554587-80554609 GTTGGTGGCAAGGATGGTGGGGG + Intergenic
993189938 5:84669145-84669167 GTGGGTGGCATTGAGGCTAGTGG - Intergenic
995468078 5:112471232-112471254 GTGGGTAGCCATGAGGCTGGAGG - Intergenic
996866216 5:128125367-128125389 GTAGGTGGCAAGGAGGAGTTTGG + Intronic
997177772 5:131796976-131796998 GGGGGTGGCGGGGCGGCTGTAGG - Exonic
997207807 5:132060244-132060266 GTGGGTGGCCAGGAGGCCACTGG - Intergenic
997241477 5:132311497-132311519 CTGGATGGGAAGGAGGGTGTAGG + Intronic
998643934 5:144041871-144041893 GGGGGCGGCGGGGAGGCTGTAGG + Intergenic
999257003 5:150215291-150215313 GTAGGAGCCAAGGAGGCTTTAGG + Intronic
1000632009 5:163601425-163601447 GTGGTTGGCTAGGGGGCTGGAGG + Intergenic
1001095222 5:168770886-168770908 GGGGGTGGCAAGGTGGGGGTGGG - Intronic
1001292245 5:170471951-170471973 GTGGGAGGCATGAAGGCTATGGG + Intronic
1001534879 5:172491306-172491328 GTGGGTGGCCAGTAGGCAGCCGG - Intergenic
1001780226 5:174361840-174361862 GGGGCAGGCCAGGAGGCTGTGGG + Intergenic
1001924315 5:175625326-175625348 GTGAGCAGCAAGGACGCTGTTGG - Intergenic
1002461891 5:179378015-179378037 CTGGCTGGAAAGGAGGCTTTGGG - Intergenic
1003008418 6:2403652-2403674 GTGGATGGAAACGAGGCTGTTGG + Intergenic
1006480972 6:34293946-34293968 GTGGGTGGGAAGAGGGGTGTGGG - Intronic
1006496265 6:34425715-34425737 GTGCCAGGCAAGGAGGCAGTCGG + Intronic
1006921910 6:37632953-37632975 GTGGGTGGCTGGGAGGATGGCGG + Exonic
1008249715 6:49225211-49225233 GAGGCTAGCAAGGGGGCTGTGGG - Intergenic
1009957540 6:70473804-70473826 GTGGGAGTCAAGAAGGCGGTGGG - Intronic
1011437755 6:87357063-87357085 CTGGGAGGCAGGGAGGGTGTAGG - Intronic
1013187916 6:107777754-107777776 GGTGGTGGCAAGGAGGGTGATGG - Intronic
1014218590 6:118777374-118777396 GTGGGAGGAAAGGAAACTGTGGG + Intergenic
1014743454 6:125172021-125172043 GAGGGAGGGAAGGAGGCAGTAGG - Intronic
1015732865 6:136365953-136365975 CCGGGTGGCAAGGAGGATGTCGG + Exonic
1017139693 6:151179444-151179466 GTGGGTGGGGAGGAGGTTGGTGG + Intergenic
1018202675 6:161410187-161410209 GTGGGTGGCCAGGAATCTGAAGG + Intronic
1018751729 6:166812421-166812443 GAGAGAGGCAAGGGGGCTGTGGG - Intronic
1018855541 6:167672041-167672063 GTGGGTGGCAGTGTGGCCGTGGG - Intergenic
1018855552 6:167672113-167672135 GTGGGTGGCAGTGCGACTGTAGG - Intergenic
1018855555 6:167672131-167672153 GTGGGTGGCAGTGTGGCCGTGGG - Intergenic
1018855572 6:167672221-167672243 GTGGGTGGCAGTGTGGCCGTGGG - Intergenic
1018855590 6:167672329-167672351 GTAGGTGGCAGTGTGGCTGTAGG - Intergenic
1019011124 6:168844274-168844296 GTCGGTGGCGGGGAGGATGTTGG - Intergenic
1019484697 7:1284177-1284199 GTGGGTGGCCTAGAGGCCGTGGG + Intergenic
1019527596 7:1487679-1487701 GTGGGTGGGACAGAGGCTGAAGG - Intronic
1020510715 7:9053766-9053788 ATGGGAGGCATGCAGGCTGTTGG - Intergenic
1021149706 7:17134666-17134688 GGGGGTGGCAGGAAGGATGTTGG - Intergenic
1021355741 7:19651469-19651491 GTTAGTGGCAGAGAGGCTGTTGG - Intergenic
1022144861 7:27527008-27527030 GGGGGTGGCAGGGAGGTGGTGGG + Intronic
1022189306 7:28001623-28001645 GGGGGTGGCAAGAAGTCAGTGGG + Intronic
1022687298 7:32608830-32608852 CTGTGTGGCCAGGACGCTGTAGG + Intergenic
1022977785 7:35574909-35574931 GAGTGTGGCAGGGAGGCTGAGGG - Intergenic
1023863397 7:44228002-44228024 GTGCGTGGAGAGGAGGCTGCAGG + Intronic
1023867009 7:44243066-44243088 CTGGGTGGAAAGGGGGCTCTTGG + Intronic
1024249907 7:47498245-47498267 ATGGGAGGGTAGGAGGCTGTTGG - Intronic
1024337979 7:48228486-48228508 GTGGGAGGCACGGGTGCTGTTGG + Intronic
1024615673 7:51109503-51109525 GTGGGGGGCAAGGAGGGAGATGG - Intronic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1026738559 7:72964361-72964383 GTGTGTGGCAAGGAGGGTGAGGG - Intronic
1026789574 7:73323004-73323026 GTGTGTGGCAAGGAGGGTGAGGG - Intronic
1027105175 7:75400708-75400730 GTGTGTGGCAAGGAGGGTGAGGG + Intronic
1027659110 7:80967737-80967759 GTTGGTGGCAATTAGGATGTTGG - Intergenic
1027761338 7:82282830-82282852 GCGTGTGGCAGGGAGGGTGTGGG + Intronic
1030133507 7:106223241-106223263 AGGGGTGGAATGGAGGCTGTGGG - Intergenic
1032079399 7:128851136-128851158 GGGGTTGGCAGGGAGGCTGCTGG + Intronic
1032505674 7:132432643-132432665 ATGGGTAAGAAGGAGGCTGTGGG + Intronic
1032667795 7:134054295-134054317 CTGGGTGGCGAGGAGGAGGTGGG - Intronic
1033282718 7:140017373-140017395 GTGGGTGGCGGTGAGTCTGTGGG + Intronic
1034885816 7:154798062-154798084 GTTGGGGGCAGGGAGGCTATGGG + Intronic
1034915326 7:155034099-155034121 GTGGGTGGCAGGGTGGGAGTTGG - Intergenic
1035244201 7:157551755-157551777 GTGGGGTGCATGGTGGCTGTGGG - Intronic
1036748892 8:11430751-11430773 GGGTGTGGCAAGGGGGCTGGAGG + Intronic
1037915172 8:22768689-22768711 GAGGGTGGCAAGGAGGTAGGGGG + Intronic
1038328813 8:26591705-26591727 GTGGGTGGCAGGTGGGCTGTGGG + Intronic
1039593339 8:38769008-38769030 GTGCGTGGATATGAGGCTGTGGG + Intronic
1039921263 8:41896119-41896141 GCGGGTGGCCGGGAGGCTGAGGG - Intronic
1040040553 8:42912654-42912676 GTGGTGGGCAAGGAGGATGTGGG - Intronic
1040342177 8:46446648-46446670 GTGGGTGGCAAGGACTCAGCGGG - Intergenic
1040895772 8:52366685-52366707 GTGGCTGGTGAGGAGGCTGATGG - Intronic
1041192499 8:55367904-55367926 CTGTGTGGCAAGTAGGCTGTGGG - Intronic
1045014068 8:97983549-97983571 TTTGGTAGCAAGGAGACTGTGGG + Intronic
1048341087 8:133538984-133539006 CTGGCTGCCAGGGAGGCTGTGGG + Intronic
1048579485 8:135719361-135719383 GAGGATGGCATGGAGGCTGAGGG + Intergenic
1048866903 8:138768089-138768111 GCGGAGGGCCAGGAGGCTGTGGG - Intronic
1049426695 8:142540995-142541017 GTGCCTGGCAAGGTGGCTGAAGG + Intronic
1049447230 8:142636824-142636846 GTGGAGGGGAAGGAGGCTGCGGG + Intergenic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049616358 8:143577384-143577406 GTTGGTGGCCACCAGGCTGTGGG + Exonic
1049787779 8:144459305-144459327 GTGGGTGGCAGGAGGGCTGGTGG - Intronic
1049805544 8:144537177-144537199 GTGGGTGGGAAGGGTGCTGGTGG + Intronic
1049877718 8:145036621-145036643 GTGGGCGCAAAGGAGGCTTTGGG - Intergenic
1050366676 9:4879509-4879531 GTGGGTGGAGAGGAGAGTGTGGG - Intronic
1052515588 9:29475243-29475265 GTTGGTGGAAAGGTGGGTGTGGG + Intergenic
1052851953 9:33383881-33383903 GTGGGAGGCTTGGAGGCTGTGGG - Intergenic
1053512613 9:38701554-38701576 GTGGGTGGCCTCGAGGCTGAAGG + Intergenic
1053680060 9:40480429-40480451 GTGGGAGGCTTGGAGGCTGTGGG - Intergenic
1053930052 9:43108739-43108761 GTGGGAGGCTTGGAGGCTGTGGG - Intergenic
1054152924 9:61619799-61619821 GGGAGTGGCAAGCAGGCAGTGGG + Intergenic
1054283652 9:63144506-63144528 GTGGGAGGCTTGGAGGCTGTGGG + Intergenic
1054293140 9:63315939-63315961 GTGGGAGGCTTGGAGGCTGTGGG - Intergenic
1054391167 9:64620432-64620454 GTGGGAGGCTTGGAGGCTGTGGG - Intergenic
1054504561 9:65895895-65895917 GTGGGAGGCTTGGAGGCTGTGGG + Intergenic
1054982276 9:71220854-71220876 GTGGGAGCCCAGGAGGCTGTTGG - Intronic
1055559905 9:77512060-77512082 GTGGGGGCCAAGCAGGCAGTGGG - Intronic
1056963282 9:91145402-91145424 GTGGGGGGAAAAGAGGCTGGAGG + Intergenic
1057146175 9:92760804-92760826 GTTGGGAGCAAGGAGGCTCTGGG - Intronic
1057518410 9:95740461-95740483 GTGGGAGGCAAGGAGGTTGAAGG + Intergenic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1057858692 9:98623042-98623064 GTGGGAGGCAAAGAGTATGTGGG + Intronic
1058111658 9:101037034-101037056 GTGGGTGGCAAGAAGGTTATGGG - Intronic
1059318580 9:113448322-113448344 GTGAGTGGCAATGGGGCTGGGGG - Intronic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1061370376 9:130194330-130194352 CGGGGTGGAAAGGAGGCTGTGGG + Intronic
1061486038 9:130920961-130920983 GTGGGAGGCCTGGAGGCTGCTGG + Intronic
1061593623 9:131614508-131614530 GTTTGTGGCCAGGAGGTTGTGGG + Intronic
1062063900 9:134515589-134515611 GTGGGTGCCAAGATGCCTGTGGG - Intergenic
1062269663 9:135702666-135702688 GGGAGTGGCAGGGAGGCTGGGGG + Intronic
1062334265 9:136058148-136058170 CTGGCTGGCAAGGGGGCTGCTGG + Intronic
1062380969 9:136286299-136286321 GGGGGCGGCAGGTAGGCTGTGGG + Exonic
1062425560 9:136504597-136504619 GTGAGGGGCAGGGAGGCCGTCGG + Intronic
1062647322 9:137555287-137555309 GCAGGTGGCCAGGAGGCTGAAGG + Exonic
1203377060 Un_KI270442v1:384687-384709 GGTGCTGGCAAGGAGGCTGGCGG + Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1185821480 X:3209012-3209034 TTGTGTGGCCAGGAGACTGTGGG - Intergenic
1188032774 X:25282776-25282798 GTTAGTGGCAAGGAGGCTTGGGG + Intergenic
1189322661 X:40096161-40096183 GCGTGTGGCAAGGAGGCTGTAGG - Intronic
1189484676 X:41421006-41421028 GTGGGGGGCAGGGGGGCTTTTGG + Intergenic
1190088462 X:47416913-47416935 GTAGGTTGCAAGGAGGCAATGGG + Intergenic
1190260537 X:48794105-48794127 GTGGGGGGCATGGGGCCTGTGGG - Exonic
1191670584 X:63745046-63745068 GTGGGTGGAGGAGAGGCTGTGGG + Intronic
1196419538 X:115507957-115507979 GCGGGTGGCAGGGAGGGGGTGGG - Intergenic
1196550465 X:117017885-117017907 TTGGGTGGCAAGGTAGCTCTTGG - Intergenic
1197278490 X:124507642-124507664 GGGGATGGCAAGAAGGCTGAGGG + Intronic
1197709152 X:129653853-129653875 GGGGGTGGGATGGAGGCTATGGG + Intronic
1198114908 X:133535621-133535643 GTGGGTTTCAAGGAACCTGTTGG + Intergenic
1198152249 X:133922659-133922681 GCGGGGGGCAAGGGGGCGGTTGG - Intronic
1199086245 X:143633800-143633822 GCGGGCGGCGAGGAGGCTGGAGG + Intronic
1199545666 X:149005313-149005335 GGGGGTGGCCAGGATGCTTTGGG - Intergenic
1201739509 Y:17308399-17308421 GAGGGTGGCAAGAAGGCAGATGG - Intergenic