ID: 1150917684

View in Genome Browser
Species Human (GRCh38)
Location 17:69453092-69453114
Sequence AACTCCTGCTCTGCGTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150917684_1150917693 24 Left 1150917684 17:69453092-69453114 CCTGATGACGCAGAGCAGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1150917693 17:69453139-69453161 CTGGGATAGGCACTAGTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 114
1150917684_1150917691 20 Left 1150917684 17:69453092-69453114 CCTGATGACGCAGAGCAGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1150917691 17:69453135-69453157 ATTTCTGGGATAGGCACTAGTGG 0: 1
1: 0
2: 1
3: 6
4: 117
1150917684_1150917692 21 Left 1150917684 17:69453092-69453114 CCTGATGACGCAGAGCAGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1150917692 17:69453136-69453158 TTTCTGGGATAGGCACTAGTGGG 0: 1
1: 0
2: 5
3: 10
4: 121
1150917684_1150917689 6 Left 1150917684 17:69453092-69453114 CCTGATGACGCAGAGCAGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1150917689 17:69453121-69453143 GAACAGGAGTGCAGATTTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 163
1150917684_1150917687 -10 Left 1150917684 17:69453092-69453114 CCTGATGACGCAGAGCAGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1150917687 17:69453105-69453127 AGCAGGAGTTTGGCAGGAACAGG 0: 1
1: 0
2: 2
3: 39
4: 478
1150917684_1150917688 5 Left 1150917684 17:69453092-69453114 CCTGATGACGCAGAGCAGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1150917688 17:69453120-69453142 GGAACAGGAGTGCAGATTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 202
1150917684_1150917690 11 Left 1150917684 17:69453092-69453114 CCTGATGACGCAGAGCAGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1150917690 17:69453126-69453148 GGAGTGCAGATTTCTGGGATAGG 0: 1
1: 0
2: 1
3: 13
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150917684 Original CRISPR AACTCCTGCTCTGCGTCATC AGG (reversed) Intronic
900585055 1:3428664-3428686 AGCTCCTGCCCTCCGCCATCAGG + Intronic
900972515 1:5999348-5999370 AACCCCTGATCTGAGTCACCAGG - Intronic
901281888 1:8043876-8043898 GACTCCTGCTCTAGGCCATCGGG + Intergenic
902743701 1:18458675-18458697 AACACCTGCTCAGCCTCATGGGG - Intergenic
903027865 1:20442435-20442457 CACTCCTGCCCAGCCTCATCTGG + Intergenic
903742699 1:25567494-25567516 TCCTCCTGCTCTGCTTCCTCAGG + Exonic
905412265 1:37778812-37778834 AGCTGGTGCTCTGCGTCAGCAGG - Intergenic
905927521 1:41762502-41762524 AACACCTGCTCTGGGGCTTCAGG + Intronic
910652313 1:89582785-89582807 GAACCCTGCTCTGCGTCAGCTGG - Exonic
914350850 1:146838946-146838968 CAATCCTGCTCTGAGTCATCTGG - Intergenic
915027929 1:152850285-152850307 CACTCCTGTTCTGCTTCATAGGG - Intergenic
917458303 1:175204815-175204837 AACTGCTCCTCTGTCTCATCAGG - Intergenic
921628009 1:217400007-217400029 AACTCCTCCTCACTGTCATCAGG + Intergenic
924743575 1:246812519-246812541 AACCCCTGCTCTGCCCTATCTGG + Intergenic
1063164372 10:3446412-3446434 AACTCTTAATCTGCGTCACCAGG - Intergenic
1064361764 10:14671993-14672015 AACTCCAGCTCTGGGAAATCAGG + Intronic
1067320511 10:45216148-45216170 AACTCCTTCTATGCCTCATCTGG - Intergenic
1069179330 10:65337071-65337093 AACTCCTGCTCTCAGTGATGAGG + Intergenic
1071709482 10:88035732-88035754 AGCTCCTCCTCTGTGTCATAAGG - Intergenic
1071908645 10:90204573-90204595 AACTACAGCTCTGCTTCAACAGG + Intergenic
1076673385 10:132135369-132135391 AACCCCTGCTCTGCGTTAGTGGG + Intronic
1076980013 11:199277-199299 AACTCAGGCTCTGAGTCAACAGG - Intronic
1078927122 11:15885084-15885106 AGCCCCTGCTCTGTGTCGTCAGG + Intergenic
1080097002 11:28419763-28419785 AATTCCTTCTCTGTGTTATCTGG - Intergenic
1081286854 11:41281240-41281262 GCCTCCTTCTCTGAGTCATCAGG + Intronic
1081661541 11:44891576-44891598 AACACCTGCTCTGGCTCACCTGG - Intronic
1083884003 11:65562142-65562164 CACTGCTACTCTGCATCATCTGG + Intergenic
1084245068 11:67851407-67851429 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
1084827622 11:71743171-71743193 GCCTCCTGCTCTGTGTCACCTGG - Intergenic
1092415640 12:8288537-8288559 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
1097354317 12:58584570-58584592 AAATACTGCTCTGCGTGAACTGG + Intronic
1098465641 12:70783634-70783656 AGCTCCTGCTCTGGGTCTGCAGG + Intronic
1103036680 12:117662536-117662558 AACTCCTGCTCTTTGTCCTGGGG - Intronic
1103293893 12:119869877-119869899 AGCTCCAGCTCAGCGTCATCAGG - Intronic
1104632361 12:130414153-130414175 AGCTCCTCCTCTGCAGCATCTGG + Exonic
1104756447 12:131272577-131272599 ATCTCCTGCTCGGCCTCCTCTGG - Intergenic
1105811980 13:24003234-24003256 AACACCTTCTCTGAGTGATCTGG - Intronic
1108358133 13:49645461-49645483 AACTTCAGCTCTGTGTCAGCCGG - Intergenic
1108542159 13:51454096-51454118 AACCCATTCTCTGCGCCATCTGG - Intronic
1110222762 13:73090664-73090686 CTCTCCTGTTCTGAGTCATCAGG + Intergenic
1111558532 13:89912797-89912819 AACTCCTGCTCTGATTCATATGG - Intergenic
1112866020 13:103899004-103899026 AATTCCTTCTCTGTGTTATCTGG - Intergenic
1117234136 14:53753449-53753471 AATTCCTTCTCTGTGTCATCTGG - Intergenic
1118725997 14:68629298-68629320 AACTCCTCCTCTGCAGCAGCAGG - Intronic
1119421674 14:74511085-74511107 GACTCATGCCCAGCGTCATCTGG + Intronic
1120340531 14:83216091-83216113 AATTCCTTCTCTGTGTTATCTGG + Intergenic
1122522588 14:102355572-102355594 CACTCCTCCTGTGCGTCATCCGG - Intronic
1127900814 15:63339553-63339575 AGCTTCTGCTCTGAGTCACCTGG - Intronic
1129432264 15:75508073-75508095 CTCTCCTACTCTGCGTCATTAGG + Intronic
1129467606 15:75732639-75732661 ACCTCCAGCTGTGTGTCATCGGG - Intergenic
1129719608 15:77870950-77870972 ACCTCCGGCTGTGTGTCATCGGG + Intergenic
1130823982 15:87524996-87525018 AATTCCTGTTCTGAGTCCTCAGG + Intergenic
1131371405 15:91885129-91885151 CCCGCCTGCTCTGCGTCACCTGG + Intronic
1138592535 16:58009925-58009947 AACTCCTCCTTGGCTTCATCTGG - Exonic
1139983186 16:70876598-70876620 CAATCCTGCTCTGAGTCATCTGG + Intronic
1140477788 16:75247588-75247610 AACTCCTTCTCTGGGTCAGGCGG + Intronic
1142613798 17:1123800-1123822 AACACCTGCTCTGCCTCCTTGGG + Intronic
1150917684 17:69453092-69453114 AACTCCTGCTCTGCGTCATCAGG - Intronic
1155382419 18:25238742-25238764 AAATGCTGCCCTGTGTCATCTGG - Intronic
1159440411 18:68471628-68471650 ACCTCCCGCTGTGCCTCATCAGG + Intergenic
1161620725 19:5295552-5295574 AAATCCTGCTCTGCCTCCTGAGG - Intronic
1162355959 19:10184973-10184995 AACAGCTGCTCTGGGTCATGCGG + Intronic
1163666590 19:18606567-18606589 TGCTGCTGCTCTGCGTCCTCGGG - Exonic
1165454671 19:35903720-35903742 AACTCAAGCTCTGCGTCCTGGGG - Intronic
926516225 2:13850380-13850402 CACTCATGCTCTGCCTCCTCCGG - Intergenic
936403314 2:112182330-112182352 AACTCCTGCTTTGCGTTGTTTGG - Intronic
938759423 2:134410853-134410875 AAATCCTGATCTGCGTCTTCTGG + Intronic
944100291 2:196018544-196018566 AATTCCTTCTCTGTGTTATCTGG - Intronic
944751799 2:202716911-202716933 AATTCCTTCTCTGTGTTATCTGG + Intronic
946103089 2:217343865-217343887 AACTCCTGCTCTGGGTATTTGGG + Intronic
1173061050 20:39661458-39661480 AGCTCCAGCTCTGCCTCATAGGG - Intergenic
1183347596 22:37316544-37316566 ACTGCCTGCTCTGCGTCCTCTGG - Intergenic
950956400 3:17058067-17058089 CACTCCTCCTCTGTGTGATCAGG - Intronic
951678936 3:25274418-25274440 AACACCTGATCTGAGTCTTCAGG - Intronic
957021731 3:75135799-75135821 TACTCCTGGTCTGCTTCATTAGG + Intergenic
961893187 3:130147146-130147168 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
962470090 3:135699094-135699116 AACTCCTCCACTACCTCATCAGG + Intergenic
965039663 3:163490307-163490329 AACACCTGCTCTGGGGCTTCAGG - Intergenic
966304366 3:178513977-178513999 CACTCCTGCTCTGAGGCGTCTGG + Intronic
966312892 3:178614666-178614688 AATTCCTTCTCTGTGTTATCTGG + Intronic
973284827 4:48403515-48403537 AACTCCTGGTCTGGACCATCTGG + Intronic
976404037 4:84641734-84641756 CCCTCCTGATCTGTGTCATCAGG + Intronic
977789855 4:101087085-101087107 AACTCCTCCTCTGCTTCTTGGGG + Intronic
977832810 4:101614384-101614406 AGCTCCTGCTCTGCTCCATATGG - Intronic
980081659 4:128350886-128350908 AACACCTGCTCTGGGGCTTCAGG + Intergenic
980481624 4:133395273-133395295 AACACCTGCTCTGGGGCTTCAGG + Intergenic
988755528 5:34244804-34244826 ACCTCCTGCTACGCGGCATCCGG - Intergenic
994179010 5:96743543-96743565 ACTTCCTGTTCTGAGTCATCAGG + Intronic
995855490 5:116587084-116587106 ACCTACTGCTCTGCGTGCTCAGG + Intergenic
1003504570 6:6729149-6729171 AACACCTGCTCTCCGTAGTCAGG - Intergenic
1012818407 6:104054125-104054147 AACTCCTGCTCTTGGCCATGAGG - Intergenic
1012969312 6:105710551-105710573 AACTCCTGCTCTCCTTCATGGGG - Intergenic
1017533386 6:155320487-155320509 AACTCCAGCTCTGTGACCTCTGG - Intergenic
1019553596 7:1617343-1617365 ATCTCATGCCCTGCGTCATGGGG + Intergenic
1036816969 8:11909529-11909551 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
1036820273 8:11934418-11934440 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
1042358970 8:67860751-67860773 AAGTCCTCCTCTGCATAATCAGG + Intergenic
1045521003 8:102903335-102903357 AACTCCTGCTGTCTGTCATGGGG + Intronic
1047222526 8:122930133-122930155 ATTTCCTGCTCTGCCTCCTCAGG + Intronic
1047358030 8:124141748-124141770 ACCTCCTGCTCTGCAGCACCTGG - Intergenic
1047758337 8:127935634-127935656 AGCTCATGCTCTGTGCCATCGGG - Intergenic
1055278434 9:74646168-74646190 AAGTCCTGATCTGCTTCCTCTGG + Intronic
1056752658 9:89363438-89363460 TCCTCCAGCTCTGCATCATCCGG + Intronic
1057719320 9:97519473-97519495 AACTCTTGCTCAGGGTCACCAGG + Intronic
1061883719 9:133580410-133580432 AGGTCCTGCTCTGCCTCAGCTGG + Intronic
1062414506 9:136441263-136441285 AACCCCTGCTCTGCACCATCTGG - Exonic
1190006556 X:46745233-46745255 AAGCCCTGCTCTGCTCCATCTGG - Intronic
1190893721 X:54595926-54595948 AATTCCTTCTCTGTGTTATCTGG + Intergenic
1195601447 X:106752805-106752827 AATTCCTTCTCTGTGTTATCTGG - Intronic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic