ID: 1150919327

View in Genome Browser
Species Human (GRCh38)
Location 17:69466659-69466681
Sequence TGGCATTTTCTTACAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150919324_1150919327 -10 Left 1150919324 17:69466646-69466668 CCGGGAAATCCCGTGGCATTTTC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1150919327 17:69466659-69466681 TGGCATTTTCTTACAGAAACAGG 0: 1
1: 1
2: 5
3: 38
4: 349
1150919321_1150919327 1 Left 1150919321 17:69466635-69466657 CCCTGTGAATGCCGGGAAATCCC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1150919327 17:69466659-69466681 TGGCATTTTCTTACAGAAACAGG 0: 1
1: 1
2: 5
3: 38
4: 349
1150919322_1150919327 0 Left 1150919322 17:69466636-69466658 CCTGTGAATGCCGGGAAATCCCG 0: 1
1: 0
2: 1
3: 2
4: 37
Right 1150919327 17:69466659-69466681 TGGCATTTTCTTACAGAAACAGG 0: 1
1: 1
2: 5
3: 38
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150919327 Original CRISPR TGGCATTTTCTTACAGAAAC AGG Intronic
900298709 1:1965824-1965846 TGGCCAATGCTTACAGAAACCGG + Intronic
900327672 1:2117119-2117141 TGGCATTTTTTTGTAGAGACAGG + Intronic
905702631 1:40029769-40029791 TAGTATTTCCTTACAGACACTGG - Intergenic
907070325 1:51528698-51528720 TTGCATTTTTTTGCAGAGACAGG - Intergenic
907360921 1:53913986-53914008 TGGTATTTTGTTACAGCAGCTGG + Intergenic
908362041 1:63378183-63378205 AGGCATTTTCAGACAAAAACTGG - Intronic
910786969 1:91009778-91009800 TGCCTTTTTCTTAAAAAAACTGG - Intronic
911382898 1:97138193-97138215 TGCCATTCTCATATAGAAACAGG - Intronic
911714246 1:101112305-101112327 TGCCATTTTCAGACAAAAACAGG - Intergenic
911726084 1:101242482-101242504 TGGCATTTCCTTCAGGAAACTGG - Intergenic
912083422 1:105968547-105968569 TGGCATCTTTTTACAGAAACTGG - Intergenic
912276064 1:108260289-108260311 TTCCATTGTCTTGCAGAAACAGG - Intergenic
912292164 1:108434069-108434091 TTCCATTGTCTTGCAGAAACAGG + Intronic
912378139 1:109229658-109229680 TGGCATTGTCTGTCAGAAGCAGG + Intronic
912434080 1:109646637-109646659 TGGCATTTTTTTACAGAAATAGG - Intergenic
916102199 1:161402221-161402243 TGGCATATACTTCCAGAAACTGG + Intergenic
917435067 1:175012673-175012695 TGGCATTTTGTTACAGCAGCAGG - Intronic
917842956 1:178997002-178997024 TGGCATCTTTTTCTAGAAACAGG + Intergenic
918905078 1:190481183-190481205 TTACATTTTATTACAGAAATTGG + Intergenic
919348144 1:196412976-196412998 TGTCATTTTCTTACAGTGCCAGG + Intronic
921455586 1:215366823-215366845 TTGCATTTTTTTCCAGAGACAGG + Intergenic
921718026 1:218438803-218438825 TTTCATTTTCTTAAAGAAATTGG + Intronic
922992216 1:229924079-229924101 TTGCTTTTTCTTCCAGAAAAAGG - Intergenic
923326002 1:232880726-232880748 TGGCATTTTCTTCAAGGATCTGG - Intergenic
923766985 1:236901545-236901567 TGGTATTTTGTTACAGGAGCAGG - Exonic
923895128 1:238261048-238261070 TGGTATTTTGTTATAGCAACAGG + Intergenic
1062778036 10:171891-171913 TGGTATTTTGTTACAGCAGCAGG - Intronic
1065073723 10:22054594-22054616 TGGTATTTTGTTACAGCAGCAGG - Intergenic
1065280447 10:24132384-24132406 TTGTATTTTCTTACAGCGACTGG - Intronic
1065986211 10:30954884-30954906 TGACCATTTCTTACAGAAAAAGG + Intronic
1068109829 10:52666889-52666911 TGACATTCTTTAACAGAAACTGG + Intergenic
1068531096 10:58187416-58187438 TGGCATGTTCTTACTTAAAAGGG - Intergenic
1069747959 10:70727749-70727771 TGGCATTTTTTTGTAGAGACAGG + Intronic
1071220723 10:83462070-83462092 AGGCAGTTTATTACATAAACTGG - Intergenic
1071433178 10:85622586-85622608 TGGCATTTTCAGACAGATTCAGG - Intronic
1071691851 10:87828658-87828680 TGGCATTTTCTTCCAATAAAAGG - Intronic
1072306021 10:94108155-94108177 TGGGATGTTCTTTCAGAAACAGG - Intronic
1073696824 10:105878725-105878747 TGGAACTTTCTTAGAGACACAGG - Intergenic
1074252277 10:111763002-111763024 TGGCATTTTGTTAGAGCAGCAGG + Intergenic
1075805167 10:125183066-125183088 TGGCATGTTCTTGCAGTGACTGG + Intergenic
1076202719 10:128571104-128571126 TAGCATGTGCTTACAGACACAGG + Intergenic
1076498624 10:130916595-130916617 TGGCATCTTCGTACAGAAAAAGG - Intergenic
1077682589 11:4257160-4257182 TGACACTTTTTTACAGAAATAGG - Intergenic
1078378256 11:10815116-10815138 TTGTATTTTTTTATAGAAACGGG - Intronic
1078765333 11:14291138-14291160 TAGAAATTTCTCACAGAAACAGG + Intronic
1078834428 11:15013630-15013652 TGTCACTTTCTTACAGACCCAGG - Intronic
1079769877 11:24445491-24445513 TGGCAGTTTTTTATAGAAATGGG + Intergenic
1082178081 11:49084982-49085004 TTCCATTTTCTTACAGATTCTGG + Intergenic
1082232826 11:49789818-49789840 TGGCATCTTCTTCCAAAAAAAGG + Intergenic
1082641287 11:55664762-55664784 TGGCTTTGTTTTACAGAAACAGG - Intergenic
1084577173 11:69996855-69996877 TGGCATTCTGTTACAGAGACAGG - Intergenic
1085450557 11:76629669-76629691 TGGCATTTCCCTTCAGAAAAAGG - Intergenic
1086617801 11:88844067-88844089 TGGCATCTTCTTCCAAAAAAAGG - Intronic
1086687639 11:89750873-89750895 TTTCATTTTCTTACAGATTCTGG - Intergenic
1086718213 11:90089022-90089044 TTTCATTTTCTTACAGATTCTGG + Intergenic
1086823311 11:91463271-91463293 TGTCATTTTCTTACTGCAATTGG + Intergenic
1087380755 11:97401750-97401772 TGGCATTTTTTTGTAGAGACAGG + Intergenic
1087478703 11:98671457-98671479 TGGCATCTTCTTACAATGACAGG - Intergenic
1087523430 11:99274813-99274835 AGACATTTTCTTACAGCATCTGG - Intronic
1087527734 11:99338588-99338610 TGACATTATTTTACAGAATCAGG - Intronic
1087707062 11:101505410-101505432 TGTCATTTTCTCTCAGAATCTGG - Intronic
1088791880 11:113233392-113233414 GGGCATGTTCCTACAGAATCAGG + Intronic
1089490812 11:118882702-118882724 TGGCTTTTTCTTCCAGAAGTGGG - Intergenic
1089933271 11:122335990-122336012 TAGTATTTTCTTACAGAATTGGG - Intergenic
1090575508 11:128098273-128098295 TGGCATTTTCTTTCAGAAAATGG - Intergenic
1091088762 11:132749278-132749300 TGGCACTTTCTTACAGTAGCAGG + Intronic
1092663099 12:10760878-10760900 TGGCATTTTTTTACAGAAATAGG - Intergenic
1093601315 12:21027668-21027690 TGGCATTTTTTTCCAGAATAGGG - Intronic
1093823202 12:23647529-23647551 TGGCATCTTCTTCCAGTAAAAGG + Intronic
1094662104 12:32479960-32479982 TTGTATTTTCTTATAGAGACAGG + Intronic
1094689989 12:32759213-32759235 TGGCATTTTGTTGCAGGAAAAGG - Intergenic
1095308455 12:40665351-40665373 TGGCATTTTCTTCCAGTATAAGG - Intergenic
1097544024 12:60976187-60976209 TGGCATTTTTTTACAGTGGCTGG + Intergenic
1097641140 12:62183554-62183576 TTGTATTTTCTTGCAGAGACAGG + Intronic
1099346126 12:81501977-81501999 GGGCATTTTCTCTCAGAAAAAGG + Intronic
1100791834 12:98138759-98138781 TGTCTTTTTCTTAAAGAAAAAGG + Intergenic
1101860179 12:108476229-108476251 CAGCATTTTCTTTTAGAAACCGG - Intergenic
1101887008 12:108673566-108673588 TGGCATCTTCTTTCAGTAAAAGG - Intronic
1103946678 12:124531211-124531233 TATCATTTTCTTTCATAAACGGG - Intronic
1104419706 12:128625202-128625224 TGGCATTTTGTTATAGCAGCTGG - Intronic
1104559320 12:129829635-129829657 TGGCATTTCCTGGCAGAAGCAGG - Intronic
1104919894 12:132285258-132285280 TGGCATTGTCCTGCAGAAGCCGG - Intronic
1105547683 13:21363250-21363272 TGGCATTTTCTTCCAGTAGAAGG - Intergenic
1106866429 13:33969366-33969388 AGCGATTTTCCTACAGAAACTGG + Intergenic
1108401741 13:50051899-50051921 TGGCATTTTCTTCCAGAATAGGG - Intergenic
1108616664 13:52140028-52140050 TGGCATTTTTTTAAAGAGATGGG - Intronic
1109074245 13:57813532-57813554 TGCCATTTTCTTGAGGAAACAGG + Intergenic
1109558718 13:64018222-64018244 AGTCATTTTCTTACATAATCAGG - Intergenic
1109701187 13:66026682-66026704 TGGCATTTTCTTCCAATAAAAGG - Intergenic
1109711223 13:66163248-66163270 AGGCAATTTCTAACAGAAATAGG + Intergenic
1109783110 13:67139022-67139044 TGGCATTTCCTTCCTGATACAGG - Intronic
1111089144 13:83419558-83419580 TGGCATTTTCTTTTAGAATATGG - Intergenic
1111336234 13:86827499-86827521 TGGCAGTTTCTCAGAAAAACAGG - Intergenic
1112140164 13:96632364-96632386 GGGCATTTTGTTACAGCAGCAGG + Intronic
1112329324 13:98464859-98464881 TGGAATTATCTCAGAGAAACTGG + Intronic
1112761945 13:102701357-102701379 AGGCATTTCCTTCCAGAACCTGG - Intergenic
1113661628 13:112110804-112110826 TGGCAATTTTTTTCAAAAACAGG - Intergenic
1113787526 13:113010424-113010446 TGACTTTTCCTCACAGAAACAGG - Intronic
1115194588 14:30782670-30782692 TGGCATTTTGTTATAGCAGCAGG - Intergenic
1116255052 14:42543177-42543199 TGGTATTTTCTTTCAGTATCTGG + Intergenic
1116509216 14:45722998-45723020 TGGCATTTTCTTCCAATAAAAGG - Intergenic
1118248415 14:64134508-64134530 TGGCATTCACTTCCAGAGACAGG - Intronic
1118527068 14:66657459-66657481 TGGCATCTTCTTACAGCAGAAGG - Intronic
1119329323 14:73782499-73782521 TTGCATTTTTTTACAGAGAAGGG + Intronic
1120150201 14:81023894-81023916 TGGCATTTTTTTGCAGAACAGGG + Intronic
1120175045 14:81284699-81284721 TGGCATCTTCTTCCAGTAAAAGG - Intronic
1120991384 14:90380471-90380493 TGGTATTTTGTTACAGTATCAGG + Intergenic
1123720527 15:23056993-23057015 TGGTATATTCTTTCAGAAATTGG + Intergenic
1124056258 15:26243379-26243401 TGGCATTTTGTTACAGCAGCTGG - Intergenic
1125302502 15:38271215-38271237 AGACATTTCCTTACTGAAACAGG - Intronic
1127853909 15:62939423-62939445 AGGCCTTTTCTCAAAGAAACTGG - Intergenic
1128139602 15:65289468-65289490 TGGCATCTTCTTTCAGAATAGGG - Intronic
1130059519 15:80559487-80559509 TGGCTTCTTCTTGCAGAAGCAGG + Intronic
1130301680 15:82684194-82684216 TGGCATCTTCTTCCAGTAAGAGG + Intronic
1132489289 16:216865-216887 TGGCATTTTTTTGTAGAGACGGG + Intronic
1134600232 16:15528095-15528117 AGGAATTTTGTTACAGCAACAGG - Intronic
1135640856 16:24118743-24118765 TGGGATGTGCTTTCAGAAACAGG - Intronic
1136648896 16:31648568-31648590 AGGCACTTTTTTACACAAACAGG + Intergenic
1137347092 16:47674016-47674038 TGCCATTATCTCACAGAAACAGG + Intronic
1137778329 16:51075179-51075201 TTGTATTTTTTTACAGAGACAGG - Intergenic
1138255426 16:55554269-55554291 TGGCATTTTCTTTCATTAAAAGG + Intronic
1138849360 16:60607587-60607609 TGGCTTTCTCTTACAGATATGGG + Intergenic
1138984866 16:62316095-62316117 TGGCTTTTTCTGACAGAGGCAGG - Intergenic
1141260845 16:82452373-82452395 TTTCATGTTCTTACAGAAAGTGG - Intergenic
1141969828 16:87473586-87473608 TGGGGTTTTCTTAGAGAAGCTGG + Intronic
1143753111 17:9045446-9045468 AGGCAGCTTCCTACAGAAACGGG + Intronic
1143907409 17:10220221-10220243 TGGCATTTTCTTATAGCAGCAGG + Intergenic
1146402855 17:32513635-32513657 TAGAATTTTCTTACAAAAATAGG - Intronic
1147453707 17:40521502-40521524 TGGCATCTTGTTACAGGAACAGG - Intergenic
1147691125 17:42315330-42315352 TGGCATTTGCTTACAGAAACAGG + Exonic
1147703646 17:42411561-42411583 AAGCATTTTCTAAAAGAAACTGG + Intronic
1148142598 17:45339095-45339117 TTGCATTTTCTTATAGAGATGGG - Intergenic
1148224224 17:45887217-45887239 TTGCATTTTTTTGCAGAAACGGG + Intergenic
1148538590 17:48461729-48461751 TGGTATTTTGTTACAGCAGCTGG - Intergenic
1149171773 17:53820738-53820760 TGTTATTTTCTTACTGAAAATGG - Intergenic
1149301710 17:55310600-55310622 TCTCATTGTCTTGCAGAAACCGG + Intronic
1149935177 17:60797867-60797889 TTGTATTTTTTTGCAGAAACGGG - Intronic
1150741316 17:67781119-67781141 TTGAATTTTTTTATAGAAACAGG - Intergenic
1150910677 17:69384351-69384373 TTGTATTTTCTTGCAGAAATGGG - Intergenic
1150919327 17:69466659-69466681 TGGCATTTTCTTACAGAAACAGG + Intronic
1152415936 17:80161889-80161911 TGGCAGTTGCTTACAGAAAATGG - Intergenic
1153194406 18:2577963-2577985 TTGTAGTTTCTTACAGAAAATGG + Exonic
1153598170 18:6750505-6750527 TGACATTCTTTTATAGAAACAGG - Intronic
1153850352 18:9088450-9088472 TGGTATTTTGTTACAGCAGCAGG - Intergenic
1154408375 18:14118498-14118520 TGTCATAAACTTACAGAAACAGG + Intronic
1154978577 18:21483247-21483269 TGACATTTTCCCAAAGAAACAGG + Intronic
1155792266 18:29988107-29988129 TTGCATTTAATTACAGAATCAGG + Intergenic
1155939349 18:31788212-31788234 TGGCATTATTTTACAGAAGGGGG - Intergenic
1156107649 18:33685058-33685080 TGGCTTTGTATTACAGACACAGG - Intronic
1156225853 18:35106595-35106617 TAGCATGTTCTTAAAAAAACAGG - Intronic
1156321024 18:36022382-36022404 TGGCATCTTCTTCCAGTACCAGG - Intronic
1158040264 18:53084881-53084903 TGGAAAATTCTTACAGAAATTGG + Intronic
1158816612 18:61105385-61105407 TGGCATTTTCTTCCAGTATAAGG + Intergenic
1158949190 18:62475949-62475971 TGCCATTTTATTACTGAAAGAGG - Intergenic
1159128683 18:64255250-64255272 TGTTATTTTTTTACAGAAACAGG + Intergenic
1159523646 18:69559666-69559688 TGAAATTTTGTTACAGAAGCTGG - Intronic
1159981735 18:74789563-74789585 TGGCTTTCTCTTACAGACAGAGG - Intronic
1159993213 18:74935350-74935372 TGACATTTTCTTAGAGCATCTGG + Intronic
1164688474 19:30188770-30188792 TGGCATGTTTTTGCAGTAACTGG + Intergenic
1166666964 19:44686040-44686062 TGGCAATTTTTTACAGGAAATGG + Intergenic
925678679 2:6394027-6394049 TGGCCTTTACTTTCAGAAAAGGG + Intergenic
926574815 2:14568436-14568458 TGGATTTGTCTTACAGAAACGGG + Intergenic
927752579 2:25682734-25682756 TTGCATTTTCTTGTAGAGACAGG + Intergenic
928162613 2:28941903-28941925 TACCAATTTCTTACTGAAACAGG - Intronic
928218840 2:29385560-29385582 TTGCATTTTTTTGCAGAGACAGG + Intronic
930159090 2:48135089-48135111 GGACATTTCCTAACAGAAACAGG - Intergenic
930474098 2:51857250-51857272 TGACATTATGTTACAGAAAATGG + Intergenic
932847101 2:75147129-75147151 TGGCATCTGCTTAGACAAACAGG - Intronic
933133870 2:78707197-78707219 TGGCCTTTTATTACAGCAGCAGG - Intergenic
933699891 2:85247145-85247167 ATCCATTTTCTTAGAGAAACTGG + Intronic
933818673 2:86089911-86089933 CGGGATTTTCTTCCAGAAACTGG + Exonic
934581813 2:95448051-95448073 TTTCATTTTCTTACAGATTCTGG - Intergenic
934591652 2:95557299-95557321 TTTCATTTTCTTATAGAATCTGG + Intergenic
934597637 2:95628663-95628685 TTTCATTTTCTTACAGATTCTGG + Intergenic
934842257 2:97634329-97634351 TTTCATTTTCTTACAGATTCTGG - Intergenic
935004585 2:99059739-99059761 TTGCATTTTTTTGTAGAAACGGG - Intronic
935726685 2:106029723-106029745 AGGCATTTTCTTACTGGAAGGGG - Intergenic
937797265 2:126038569-126038591 TGGCATTTTATTATAGCAGCAGG - Intergenic
938995851 2:136676961-136676983 CGGCAGTTTCTTCCAGAATCCGG - Intergenic
940389557 2:153116458-153116480 TGGGATTTTCATATAGAAATAGG + Intergenic
940823018 2:158378537-158378559 TGGCATTTTCTTTCAGCATAAGG - Intronic
941405025 2:165076518-165076540 TGTCCTTTTCTTACAGATTCAGG + Intergenic
941438190 2:165498080-165498102 TGTCACTTACTTACAGAAAGGGG - Intronic
942272733 2:174293249-174293271 TGGCTTTTTTTTACAAAAATAGG - Intergenic
942746399 2:179238589-179238611 TTCTAGTTTCTTACAGAAACTGG - Intronic
942958529 2:181802659-181802681 TGGCATGTTTTTGCAGCAACTGG + Intergenic
943016729 2:182520530-182520552 TGTCATTTTATTTCAGAAAAGGG - Intronic
943458479 2:188138690-188138712 TGGTATTTTCTTAGTGAAATGGG - Intergenic
945582214 2:211609546-211609568 AGGCATTTTTCTTCAGAAACAGG + Intronic
945827554 2:214742737-214742759 TGGCATTTGGTTACATATACAGG - Intronic
946156942 2:217813262-217813284 AGGCATTTTCTGATAGAGACTGG - Exonic
947203343 2:227636936-227636958 TGTTATTTTCTTACTGTAACAGG - Intergenic
947800194 2:232924456-232924478 TGGTATCTTGTTACAGCAACTGG + Intronic
947804208 2:232953870-232953892 AGACATTTTCTGATAGAAACCGG + Intronic
948355330 2:237373035-237373057 TTGCATTTTCTTGGAGAAATAGG + Intronic
948992977 2:241564043-241564065 GAGCATTTTCTGACAGAATCCGG + Intronic
1169423068 20:5475027-5475049 TGGCATTTTCTGACACATTCTGG - Intergenic
1170272263 20:14540479-14540501 TGGCAGTTTCTTTCAGAATGTGG + Intronic
1171249117 20:23635408-23635430 TGTCAGTTTCTTACACACACAGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1172607839 20:36226910-36226932 TGGTTTTTCCTTACAGTAACAGG - Intronic
1173010672 20:39178871-39178893 TGGTATTTTGTTACAGCAACAGG - Intergenic
1173041282 20:39465696-39465718 TGGCAATTTGTTACAGCAGCTGG - Intergenic
1174698386 20:52583011-52583033 TGGGGTTTTTTTACAGAAAAGGG + Intergenic
1178809259 21:35866457-35866479 TTAAATTTTTTTACAGAAACAGG - Intronic
1179074908 21:38111879-38111901 TGGCAGTTTCTTACAAAATTAGG - Intronic
1179603653 21:42497614-42497636 TGGCATTTTATTATAAAAATAGG - Intronic
1180290230 22:10843319-10843341 TTTCAGTTTTTTACAGAAACAGG + Intergenic
1180651943 22:17384836-17384858 TGGCATTTTCTTTCAATAAAAGG + Intronic
1181130433 22:20728382-20728404 TGGAACTTTCTTAAAGAAACAGG + Intronic
1181642147 22:24207732-24207754 TTGCATTTTCTGATAGAGACAGG + Intergenic
1183022252 22:35036749-35036771 TGGTATTTTGTTACAGCAGCAGG - Intergenic
1184185017 22:42858516-42858538 TTGCATTTTTTTATAGAGACGGG - Intronic
1184622559 22:45693300-45693322 AGGCATTTTGTTATAGCAACTGG - Intronic
1185005537 22:48274500-48274522 TGGCATTTTTTTGTAGAGACAGG - Intergenic
1185082354 22:48716890-48716912 TGGAATTTTCTAAAAGAAATGGG + Intronic
1185100358 22:48836971-48836993 TGCCATTTTCCTCCAGAAACAGG - Intronic
950166967 3:10808533-10808555 AAGCATTCTCTCACAGAAACAGG + Intergenic
951044253 3:18020477-18020499 TCACATTTTCTTGTAGAAACTGG - Intronic
951620686 3:24598838-24598860 TGGAATTTTTTTACAAACACTGG + Intergenic
951879577 3:27466654-27466676 TGGTATTTTTTTATAGAGACGGG - Intronic
951976100 3:28510798-28510820 TTGACTTTCCTTACAGAAACTGG - Intronic
952535837 3:34307907-34307929 TGGCATATCCTTACAGTATCAGG + Intergenic
952619859 3:35324771-35324793 TGTCATTTTCTGACAGACCCAGG - Intergenic
953291876 3:41673423-41673445 TGGCATTTCCTTTTAGGAACTGG - Intronic
955632110 3:60985753-60985775 TGGTAATTTGTTACAGCAACAGG - Intronic
955951876 3:64250796-64250818 TGGCATGGTCTTATAGACACTGG + Intronic
956182257 3:66528396-66528418 TGGTAATTTGTTACAGCAACAGG + Intergenic
956582165 3:70826124-70826146 TAGTATTTTCTTACAGCAGCTGG + Intergenic
958012236 3:87894427-87894449 TTGTATTTTCTTACAGAGACAGG + Intergenic
958637073 3:96759034-96759056 TTGCATTTTCTTACTTAAAAGGG + Intergenic
959522980 3:107341346-107341368 TTGCATTTTATAACACAAACAGG - Intergenic
960488726 3:118283816-118283838 TGGTATTTTTTTATAGAGACGGG - Intergenic
962305363 3:134281379-134281401 TGGCATCTTCTCACTGACACAGG - Intergenic
964038958 3:152235384-152235406 TGAAATGTTCTTACAGAAAAGGG + Intergenic
964398776 3:156276502-156276524 TGGCATCTTCTTACAAAAGAAGG + Intronic
964591893 3:158373896-158373918 TGGCTTTTGCTCACAGAAAATGG + Intronic
964610981 3:158614662-158614684 TGGCATTTTTTTGTAGAGACAGG + Intergenic
965970707 3:174552621-174552643 TGGTATTTTTTTGCAGAGACAGG - Intronic
966024588 3:175260317-175260339 TGGCATTGTCTTCTAGAAAGAGG + Intronic
967164598 3:186769224-186769246 TGTCATTTTGTTACAGGAAGGGG + Intergenic
967520803 3:190430340-190430362 TGGCCTTTTCTTCCACTAACTGG + Intronic
969121537 4:4914848-4914870 TGGCATTTTCTACAAAAAACAGG + Intergenic
969287070 4:6209478-6209500 TGGGATTTTCCTCCAGGAACAGG + Intergenic
969305092 4:6321705-6321727 TGGCATTTTGATTCAGAAAGTGG - Exonic
969440587 4:7214494-7214516 TGGTATTCTGTTACAGAAAGAGG + Intronic
970075713 4:12217172-12217194 TGGTATTTTCTTATGGCAACCGG - Intergenic
970116065 4:12696654-12696676 TGGCATTTATTTACAGCAAGAGG - Intergenic
971106700 4:23533699-23533721 TGGCATTTTGTTATAGCATCAGG - Intergenic
971411263 4:26375129-26375151 TTGTATTTTTTTGCAGAAACAGG - Intronic
971427169 4:26527633-26527655 TGGTTTCTTCTCACAGAAACAGG - Intergenic
971674646 4:29610813-29610835 TGTCCTTTTCTATCAGAAACAGG + Intergenic
972789895 4:42361470-42361492 TAGCATTTACTTACAGCAAGAGG + Intergenic
973563362 4:52159386-52159408 TTGCATTTTTTTATAGAGACAGG + Intergenic
973766330 4:54166578-54166600 TGGCATTTTATTACAGCAGCAGG - Intronic
974648162 4:64720068-64720090 TGGCATTTTATTAGCCAAACTGG + Intergenic
975132309 4:70841862-70841884 TGTCATTTTTATACAAAAACAGG + Intergenic
976513882 4:85942064-85942086 AGGCATTTTTGGACAGAAACTGG + Exonic
977752979 4:100631994-100632016 TGGCAATATCTTACAAAAATGGG - Intronic
977955764 4:103023901-103023923 TGGCATTTTCTCCAAGTAACAGG - Intronic
978146127 4:105373990-105374012 TAACATTTACTTACAGAAAATGG + Intronic
979587083 4:122433104-122433126 TGGCATTTTTTAGTAGAAACGGG - Intergenic
979865716 4:125750710-125750732 TGGCATTTTGTTTCACAAATTGG + Intergenic
980058220 4:128099799-128099821 TGGCATTTTCTTATAAAGATAGG - Intronic
980071557 4:128247802-128247824 TGTCATTTTCTGACAGGCACAGG - Intergenic
980648352 4:135675616-135675638 TGACATTTTCCTACAAAAATTGG + Intergenic
980821206 4:138019928-138019950 TGTCAATTTCTTAAAGAAAAAGG - Intergenic
981640016 4:146931040-146931062 TGAAATTTTCTTAAAAAAACTGG + Intronic
982125885 4:152183436-152183458 TGGCATTTTGTTACAGCAGCAGG - Intergenic
982902434 4:161024287-161024309 AGGCATTTTTTGAGAGAAACAGG + Intergenic
983341931 4:166471812-166471834 TGTCATTTTTTTATAGAGACAGG - Intergenic
983400545 4:167259199-167259221 TACCATGTTCTTACATAAACTGG + Intergenic
984217659 4:176934522-176934544 TGGCACTTTGTTAGAGTAACTGG - Intergenic
984428951 4:179624155-179624177 TTGTATTTTTTTATAGAAACAGG - Intergenic
985213328 4:187619373-187619395 TGGCATAATCTTCCAGAATCCGG - Intergenic
987299739 5:16586764-16586786 TGGTATTTTGTTACAGCAGCTGG - Intronic
987610611 5:20198598-20198620 TTGCATTTTCTTAAAAAAATGGG - Intronic
987632707 5:20495588-20495610 TGGCATCTACCTACAGAAACAGG + Intronic
988011259 5:25488924-25488946 TGTCACTTTCTGACAGAACCAGG - Intergenic
988092943 5:26566904-26566926 TGGCATTTTCTGGTAGACACTGG - Intergenic
988838912 5:35064016-35064038 TGGCATTTTACTCCACAAACGGG + Exonic
988926760 5:35998018-35998040 TGGCAGGCTATTACAGAAACTGG + Intergenic
992762439 5:79962509-79962531 TGGCATTTCCTCACAGACACTGG + Intergenic
993091562 5:83433006-83433028 TGGTATTTTGTTACAGCAGCAGG - Intergenic
993509719 5:88756553-88756575 TGGCAATTTATTACATAACCTGG - Intronic
995069060 5:107897221-107897243 TGGCATTTTTTTCCAGAATAGGG - Intronic
996093798 5:119377228-119377250 TTGCATTTTCTGATAGAGACAGG - Intronic
997867547 5:137478089-137478111 TGGGATTTTCTAGCAGAACCAGG + Intronic
998774965 5:145589021-145589043 TTGTATTTTCTTCCAGAAAGAGG + Intronic
1001175990 5:169469404-169469426 TGGTATTTTTTTATAGAGACGGG - Intergenic
1002259591 5:177984288-177984310 TTGGTTTTTCTTCCAGAAACGGG - Intergenic
1002688477 5:181034154-181034176 TGGCTTTTTTTTAAAGAGACAGG - Intergenic
1005382768 6:25254264-25254286 TGGCTTTTACTTACAGCTACAGG - Intergenic
1006797331 6:36740156-36740178 TGGCATTTACTGAGTGAAACGGG - Intergenic
1007183551 6:39948480-39948502 GGACATTGTCTCACAGAAACTGG - Intergenic
1009463423 6:63941616-63941638 TGGCATTTTTTTCCAGAATAGGG - Intronic
1009767513 6:68100226-68100248 TTGTATTTTTTTATAGAAACCGG - Intergenic
1011208460 6:84928007-84928029 CTGCATTTTCTTAAAGAACCAGG - Intergenic
1011841648 6:91508373-91508395 TTGAATTTTCTTTCAGAAACTGG + Intergenic
1012124376 6:95409209-95409231 TGGAATTTTCTTCCAGAAAGTGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1014034930 6:116755618-116755640 TGGCATTTTCTTCCAAAATGAGG - Intronic
1014336461 6:120142711-120142733 TGGTATTTTGTTACAGAGGCAGG + Intergenic
1014379580 6:120723673-120723695 TGGTATTTTTTTATAGAAATGGG - Intergenic
1014932907 6:127354986-127355008 TGGCATTTTTTCACAGAAATAGG + Intergenic
1015449239 6:133345608-133345630 TGTCACTTTATTACTGAAACAGG - Intronic
1016109663 6:140206643-140206665 TGGGATTTTTTTTTAGAAACAGG - Intergenic
1016149549 6:140722520-140722542 TGGAATTTGCTTATAGAATCTGG + Intergenic
1017086995 6:150722752-150722774 TAACATTTTCTTAAAGAAAAAGG - Intronic
1017298736 6:152831759-152831781 TAGCATGTTCTAACAGACACGGG + Intergenic
1018073073 6:160183408-160183430 TGGCATGTTTTTGCAGTAACTGG - Intronic
1020217092 7:6201478-6201500 TGACATTTTCAGACACAAACTGG + Intronic
1020534807 7:9383436-9383458 TGTCATTTTTTTACAGAATTAGG - Intergenic
1020544420 7:9506189-9506211 TTGCATTTTCTTTAACAAACAGG - Intergenic
1021012376 7:15486252-15486274 TGGAATTTTCTGACAGTAACGGG + Intronic
1022731712 7:33032626-33032648 TTGCATTTTTTTGTAGAAACAGG + Intronic
1023559107 7:41453620-41453642 TGGTATTTTATTAGAGCAACTGG + Intergenic
1024695734 7:51855058-51855080 TGGCATTTGCTTACAGCAAGAGG + Intergenic
1024937460 7:54725418-54725440 TGGCATTTTCTTTCTCATACAGG - Intergenic
1028476740 7:91262445-91262467 TAGCATTTTTTTAAAGCAACAGG - Intergenic
1030710477 7:112742996-112743018 TGGCTTTTTCATCCAGAAATTGG - Intergenic
1030827050 7:114170945-114170967 TGGCATCTTCTTACAATAAAAGG - Intronic
1030905493 7:115176119-115176141 TGGCATTTTCTTAAAGTTAGAGG + Intergenic
1031359433 7:120830268-120830290 TGTCATTTTTTTACAGAAACAGG + Intronic
1031534706 7:122919066-122919088 TCCCATTCTCCTACAGAAACTGG + Intergenic
1033812034 7:145026361-145026383 TGTCATTTTTTAACAGAAATAGG + Intergenic
1034010260 7:147521927-147521949 TGGCATTTGGTTACAGTAGCTGG - Intronic
1034075464 7:148227015-148227037 TGGGATTTTCCTTCAGTAACAGG + Intronic
1034419985 7:150985279-150985301 TTGCATTTTTTTTCAGAGACAGG + Intergenic
1035243987 7:157550575-157550597 TGGCATTTCCTGGCAGGAACAGG + Intronic
1035479986 7:159174415-159174437 TGGCATCTTCTTCCAAAAGCTGG + Intergenic
1035845588 8:2861081-2861103 AGGCATTTTTTTAAAGAAAATGG - Intergenic
1036557526 8:9873408-9873430 TGGTATTTTGTTACAGCAGCTGG + Intergenic
1036731331 8:11268153-11268175 ACACATTTTCTTTCAGAAACGGG + Intergenic
1037569281 8:20145112-20145134 TTTCATTATCTTTCAGAAACAGG - Exonic
1037973272 8:23190402-23190424 GAGCATTTTCTTAGAAAAACTGG - Intergenic
1038312231 8:26453501-26453523 TTGTATTTTGTTACAGAGACGGG + Intronic
1039943855 8:42113700-42113722 TGGCATTTTCTTATAGCAGCAGG - Intergenic
1040291840 8:46129564-46129586 TGGCATTTTCCTAGAGACACAGG + Intergenic
1040359005 8:46647084-46647106 TGTCATTTTCATACATAAACAGG + Intergenic
1040375008 8:46816563-46816585 TGTCATTCTCTCACAGTAACAGG + Intergenic
1041595203 8:59642670-59642692 AGGCATTTTTTTAAAGAGACAGG + Intergenic
1043064413 8:75549166-75549188 TGTTATTTTCTTAAATAAACTGG + Intronic
1045132893 8:99177058-99177080 TGGCATTTTTTTCCAGAATAGGG - Intronic
1045225610 8:100242240-100242262 TGGAGTTTACTTACAGAAATGGG + Intronic
1045334292 8:101184613-101184635 TGGCATTTTCTTAAAGTGGCAGG + Intronic
1045340085 8:101245901-101245923 TGGGATTTTATTGCAGAAATAGG + Intergenic
1045607815 8:103797526-103797548 TGGAATTTACTTAAAGAATCTGG + Intronic
1045747198 8:105437490-105437512 TGACATTTTCTATCAGATACGGG + Intronic
1047218734 8:122901285-122901307 TGACATTTTCTTCCAGAAGCAGG - Intronic
1047636904 8:126773781-126773803 AGGCATTTTGTTACAGCAGCAGG - Intergenic
1047857110 8:128922769-128922791 TGGCTTTCTCCAACAGAAACAGG + Intergenic
1048188898 8:132270353-132270375 AGGCATTTTATTGCAGAAATGGG + Intronic
1048422333 8:134289357-134289379 TGTCACTTTCTTAGAGAAAGTGG - Intergenic
1049878042 8:145039878-145039900 TGTCATTTTCTTACAACAAGAGG - Intergenic
1050046406 9:1550932-1550954 TGGCATATACTTAGACAAACAGG - Intergenic
1050047701 9:1564722-1564744 TGGAATTTTATTAAATAAACTGG - Intergenic
1050311815 9:4361003-4361025 TGACATTTTCTTTCTGAAACAGG + Intergenic
1050434624 9:5596192-5596214 TGGCATTTAATTACAGAAGTAGG - Intergenic
1050529512 9:6576147-6576169 TGGCATTTTGTTATAGCACCTGG - Intronic
1052608565 9:30738513-30738535 TGACATTTTTTCACAGAAATAGG - Intergenic
1052679294 9:31668281-31668303 TCTCATTTTCTGACAGAAAATGG + Intergenic
1054917355 9:70507522-70507544 TGGCATTTAATTCAAGAAACTGG - Intergenic
1055355965 9:75437154-75437176 AGGGATTTTCTTCCAGAAACAGG - Intergenic
1055526870 9:77143520-77143542 TGACATTTTCTATCAGCAACAGG + Intergenic
1056162385 9:83909759-83909781 TGGCATTTTATTCCATAAATAGG + Intronic
1056357958 9:85821746-85821768 TGGCATTTTATTCCATAAATAGG - Intergenic
1056370870 9:85953036-85953058 TTGTATTTTCTTATAGAGACGGG - Intronic
1056960907 9:91122155-91122177 TGGTATTCTGTTACAGCAACAGG - Intergenic
1060618379 9:125040181-125040203 TTGTATTTTCTTATAGAGACGGG - Intronic
1186556613 X:10566840-10566862 TGACATTTTCTGGCAGAAAGGGG + Intronic
1187534509 X:20127269-20127291 TAGCTTTTTCATTCAGAAACTGG + Exonic
1188228350 X:27629831-27629853 TGGCATTTTTTTACAGACATAGG - Intronic
1189099221 X:38171867-38171889 TGGCATTTTCTTACCCACACAGG + Exonic
1189773566 X:44449894-44449916 TGGCATTTTGTTATAGCAGCAGG + Intergenic
1189841891 X:45088486-45088508 TGAGTTTTTTTTACAGAAACAGG + Intronic
1190288926 X:48979090-48979112 TGGCATTTTCTTTCTGCAAGTGG - Intronic
1191001713 X:55666508-55666530 TGGCAATTTCTCAAAGAAATCGG - Intergenic
1193031068 X:76898533-76898555 TGGCATGTTTTTGCAGAAGCCGG - Intergenic
1193228925 X:79019992-79020014 TGTCACTTTCTTACAGTACCAGG + Intergenic
1193453767 X:81703279-81703301 TGGCATTTTTTTTCAGGAAGGGG + Intergenic
1194114205 X:89875127-89875149 TGGCATTTTATTTCAGAATAGGG + Intergenic
1194996888 X:100600820-100600842 TTACCTTTTCTTTCAGAAACTGG - Intergenic
1195118305 X:101722470-101722492 TGGCATTTTGTTACAGCAGTTGG + Intergenic
1196251813 X:113469657-113469679 TGTCATTTTCTGACAGACCCAGG + Intergenic
1197065646 X:122231004-122231026 TGTCATTTTCTAACAGACCCAGG + Intergenic
1197398919 X:125964558-125964580 TGGCATTTTGTTATAGTAGCAGG + Intergenic
1197973624 X:132141348-132141370 TGGTATTTTGTTACAGCATCTGG + Intergenic
1198772348 X:140144478-140144500 TGACATATTTTTAGAGAAACAGG + Intergenic
1199045788 X:143170023-143170045 TGTAATTTTGTTACAGAATCCGG - Intergenic
1199611098 X:149614863-149614885 TGACATTTTCTTTCTGAAAAAGG - Intronic
1200466945 Y:3530494-3530516 TGGCATTTTATTTCAGAATAGGG + Intergenic
1201952824 Y:19584572-19584594 TGGCATGTTTTTACAGTAGCTGG + Intergenic
1202087280 Y:21152205-21152227 TGACATTATCTCACAGATACAGG + Intergenic