ID: 1150920948

View in Genome Browser
Species Human (GRCh38)
Location 17:69481710-69481732
Sequence CCTTATATGAAGAGGAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2827
Summary {0: 4, 1: 92, 2: 401, 3: 895, 4: 1435}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150920948 Original CRISPR CCTTATATGAAGAGGAAATT TGG (reversed) Intronic
Too many off-targets to display for this crispr