ID: 1150921952

View in Genome Browser
Species Human (GRCh38)
Location 17:69493463-69493485
Sequence AAAAATACTCAGCTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150921952 Original CRISPR AAAAATACTCAGCTGCAGCT GGG Intronic
900152398 1:1184371-1184393 CAGAAAACTCAGCTGCGGCTTGG - Intronic
901543389 1:9936833-9936855 AAAAATATGCAGCTGCGGCCAGG + Intronic
901815132 1:11789430-11789452 AACAAGTCACAGCTGCAGCTGGG - Exonic
902320891 1:15664964-15664986 AAAGATAACCAGTTGCAGCTAGG + Exonic
903156340 1:21446121-21446143 GAAGCTACCCAGCTGCAGCTGGG - Intronic
903467904 1:23565143-23565165 AAAAATACTGAAATTCAGCTGGG + Intergenic
904246473 1:29191704-29191726 AAAAGGACTCAGCTTCAGCCTGG - Intergenic
904672420 1:32175800-32175822 AAAAATCCACATCTTCAGCTGGG + Exonic
905686271 1:39911000-39911022 AAAAAAAATTAGCTGCGGCTGGG - Intergenic
907008522 1:50941000-50941022 AAAAATACTTGGATGCAGTTTGG + Intronic
909069256 1:70974701-70974723 AAAAATAATCAGCTGGAGGGTGG - Intronic
909598970 1:77441451-77441473 AAAAAGACTCATCTACAGTTGGG + Intronic
911125079 1:94333859-94333881 AAAAAAAGTCAGATGCAGCTGGG + Intergenic
912059654 1:105651012-105651034 AAAAATTTTCAGCTGCAGCCTGG - Intergenic
914499501 1:148233045-148233067 ACAAAAAATTAGCTGCAGCTGGG + Intergenic
916260459 1:162836777-162836799 ATAAACACTGAGCTGGAGCTAGG + Intronic
918162822 1:181917271-181917293 AAAAAGACCCAGCAGCAGCGTGG + Intergenic
918362964 1:183778009-183778031 AAAATTTTTAAGCTGCAGCTCGG + Intronic
918568991 1:185965080-185965102 AAAATACCTCAGCTGAAGCTAGG + Intronic
918998642 1:191797408-191797430 AAAAATACTAATCTACAGATTGG + Intergenic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919364428 1:196639273-196639295 AAAAATAGTCACCCTCAGCTGGG + Intergenic
919683461 1:200458785-200458807 GAAAATACTCAGCTGGATCTAGG + Intergenic
921181395 1:212634476-212634498 AGTAATACTTAGCTGCAGCATGG + Intergenic
922673194 1:227530633-227530655 AAAGATACAGAGCTGCAGCATGG - Intergenic
923614375 1:235524684-235524706 AAAAATCCTGACCTGCAGTTTGG - Intergenic
1062816085 10:501140-501162 AAAAATACTGAGTTGCAGGGAGG + Intronic
1063687882 10:8256012-8256034 AAAAATGATCTGCTGCAGCTTGG - Intergenic
1064071215 10:12229593-12229615 AAAAATACTCTGCAGCACCAAGG - Intronic
1064184744 10:13151914-13151936 AAAAAAAATAAGCTGCAACTAGG - Intergenic
1064190824 10:13204147-13204169 ACAAATGCTCAGCTGCAGTAAGG - Intronic
1066196989 10:33110149-33110171 AAAAAAACCCAGCTGCAGGGGGG - Intergenic
1067350476 10:45471346-45471368 CAAGATCCTCAGCTGCAGCATGG - Intronic
1068107560 10:52638179-52638201 ATAAATACTCAGCATCAGCCGGG + Intergenic
1068217111 10:53996575-53996597 AAAAATACTAATCTGCAGAAAGG + Intronic
1068266215 10:54653428-54653450 AAAAATACACACCTTCAGTTTGG - Intronic
1068763861 10:60741534-60741556 AAAGATACTCATATGGAGCTGGG + Intergenic
1069272380 10:66545645-66545667 AAAAATACTCATATGTTGCTGGG - Intronic
1069297926 10:66870123-66870145 AAAAATTCTCAGCTGAAACATGG - Intronic
1069494452 10:68890315-68890337 AATAATAAGCAGCAGCAGCTGGG - Intronic
1070194045 10:74140090-74140112 AAGGATGCTCAGCTGCAGGTGGG - Intronic
1070592273 10:77809656-77809678 AAAAAGTCCCAGCTGGAGCTTGG - Exonic
1070844554 10:79511553-79511575 AAAAATACCCATCTGCAAGTGGG - Intergenic
1070929245 10:80248755-80248777 AAAAATACCCATCTGCAAGTGGG + Intergenic
1072067220 10:91883055-91883077 AAAAATAGTCTTCTGCAGCCAGG + Intergenic
1072960197 10:99922489-99922511 AAAAAAAAACAGCAGCAGCTAGG - Intronic
1073033613 10:100547724-100547746 AAAAATGATCATCTGCAACTGGG - Intronic
1073269965 10:102254236-102254258 AAAAATACTCTCCTGTAGCCAGG + Intronic
1075794775 10:125112092-125112114 AAAAAAAGTCAAATGCAGCTGGG - Intronic
1076622370 10:131799810-131799832 AAAATTACTCAGGAGCACCTTGG + Intergenic
1076844893 10:133065288-133065310 AAACATACAGAGCTGCAGCTGGG - Intergenic
1078298091 11:10095552-10095574 AAAAAAAATCAACTGCTGCTAGG + Intronic
1078505343 11:11936646-11936668 AGAAGTACTCAGCAACAGCTTGG + Intronic
1078525088 11:12094399-12094421 TGAAAAACTCAGCTACAGCTGGG + Intronic
1078975385 11:16468842-16468864 AAAAATACACAGCCTGAGCTAGG - Intronic
1079486494 11:20940840-20940862 AAAAATACCCACCTCCAGCCAGG + Intronic
1079949439 11:26783668-26783690 AAAATTCCTCATCTCCAGCTGGG - Intergenic
1080053985 11:27886240-27886262 TAAAAGACTCAGCTTCAGTTTGG + Intergenic
1080870573 11:36233311-36233333 TAAAATACTCAGCTAGAGCAGGG + Intergenic
1081491635 11:43574055-43574077 AAAAATAAACAGCTGCTGATGGG + Intronic
1084733210 11:71087922-71087944 AAAAATAGTCAAATGCAGCCAGG - Intronic
1085597883 11:77826807-77826829 AAAAATACTGAATTGGAGCTGGG + Intronic
1086376391 11:86204992-86205014 TAAAATACTGAGCTGTGGCTGGG - Intergenic
1086455302 11:86954840-86954862 GAAAGTTGTCAGCTGCAGCTCGG + Exonic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1092281278 12:7099632-7099654 AACAAGCCTCAGCTGCAACTGGG - Intronic
1092986675 12:13852284-13852306 AATGATATTCAGCTGCAACTAGG + Intronic
1093647949 12:21610468-21610490 TGAAATAATCAGCTGGAGCTGGG + Intergenic
1094426547 12:30322358-30322380 AAAAATAAACATTTGCAGCTGGG - Intergenic
1095863439 12:46945543-46945565 AAAAATATAAAGCAGCAGCTGGG + Intergenic
1097061987 12:56292100-56292122 AAAAGTTCTAAGTTGCAGCTGGG + Intronic
1097611667 12:61830851-61830873 AAAAATATTCAGCTGAACCAAGG - Intronic
1097900124 12:64864442-64864464 AAATCAACCCAGCTGCAGCTGGG - Intronic
1099410291 12:82317361-82317383 AATAATTCTCAGCTACACCTTGG + Intronic
1100484779 12:95014790-95014812 AAAACTACTCAGCTACAGACTGG - Intergenic
1100695344 12:97086717-97086739 AAACATTGTCAGCTGCAGGTTGG + Intergenic
1100989805 12:100239678-100239700 AAAAATTCTCAGCTAAGGCTTGG - Intronic
1105773679 13:23636826-23636848 AAAAATGCTCTGCTGAAACTAGG - Intronic
1106159228 13:27185612-27185634 AAAAAAAATCAGCTGGGGCTGGG + Intergenic
1106511511 13:30417384-30417406 AAAAAAATTCAGCTCCACCTGGG + Intergenic
1107194831 13:37637883-37637905 CAATATACTCAGCTGCACGTTGG - Intronic
1107485241 13:40820450-40820472 AGAAAAAATCACCTGCAGCTAGG + Intergenic
1110003853 13:70240153-70240175 AAAAATATGCACCTGCAGCTGGG - Intergenic
1110417316 13:75267693-75267715 AAGAATACTCAGATGCGGCAGGG + Intergenic
1112364112 13:98742229-98742251 AAAACCACTCAGCCGCAGCCTGG + Intronic
1112744448 13:102510842-102510864 AAAAATATTCAACTGCTGCTTGG + Intergenic
1113278954 13:108767395-108767417 AAAAATACCCAGATACAGCCAGG - Intronic
1116648912 14:47565402-47565424 AATAATACTGAGCTGAACCTTGG - Intronic
1116971559 14:51071502-51071524 AAAAATTCTGAGCTGCAGCTGGG + Intronic
1120245394 14:81999757-81999779 CAAAATAATTAGTTGCAGCTCGG - Intergenic
1121288005 14:92751587-92751609 AAAAATAGTAGCCTGCAGCTGGG + Intergenic
1121386737 14:93534303-93534325 AAAGTTACTCAGCTGCAACATGG - Intronic
1121486596 14:94321249-94321271 AAAAAGATGCAGCTGCAGATGGG - Intronic
1123474750 15:20581876-20581898 ACAAAAAAGCAGCTGCAGCTTGG + Intergenic
1123643261 15:22418481-22418503 ACAAAAAAGCAGCTGCAGCTTGG - Intergenic
1123893355 15:24803239-24803261 AAAAGTTCAGAGCTGCAGCTGGG + Intergenic
1127439363 15:58990998-58991020 ACAAATACTTAGCTGAGGCTGGG + Intronic
1128603080 15:69014455-69014477 AAAAATACTATGGTGAAGCTAGG - Intronic
1128778125 15:70339457-70339479 AAACATACTCAGCTGCTTCACGG - Intergenic
1129512630 15:76136237-76136259 AATAATACACAGCTGCAGGCCGG - Intronic
1131656219 15:94461732-94461754 AAAAATACTAAGCAGAAGATGGG + Intronic
1132233578 15:100202293-100202315 AAAAAAAATCATCTGCACCTTGG - Intronic
1132981493 16:2740545-2740567 AACAATTCTCTGCTGCACCTAGG + Intergenic
1133439810 16:5811436-5811458 AAAAATACTTTGTTCCAGCTGGG - Intergenic
1134270667 16:12730295-12730317 AAACTAAGTCAGCTGCAGCTTGG - Intronic
1135016430 16:18927752-18927774 AAAAAAACAAAGCAGCAGCTGGG + Intergenic
1135132140 16:19861914-19861936 AAAAAGACCCAGTGGCAGCTTGG - Exonic
1135159597 16:20082030-20082052 AAATTTACCCAGGTGCAGCTTGG - Intergenic
1136154774 16:28375273-28375295 AAAAATACTGAGATACCGCTAGG + Intergenic
1136208318 16:28739985-28740007 AAAAATACTGAGATACCGCTAGG - Intergenic
1136264403 16:29106666-29106688 AAAAATACTGAGATACTGCTAGG - Intergenic
1136363552 16:29797415-29797437 GACACTACCCAGCTGCAGCTTGG - Intronic
1138869187 16:60860572-60860594 AAAAATAGTGAGCAGGAGCTAGG + Intergenic
1139767567 16:69244267-69244289 AAAAAAACTAAGGTGCAGCACGG + Intronic
1139914757 16:70421167-70421189 AAGACTGCTCAGCTGGAGCTCGG - Intronic
1140528030 16:75640219-75640241 AAATATAGTCACCTGCAGCCTGG - Exonic
1141205303 16:81928745-81928767 CTAAATACTCAGCTTCAGCCAGG - Intronic
1141668852 16:85480874-85480896 AATAATACTCCGGAGCAGCTGGG + Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1143082433 17:4391810-4391832 AAAAATACAATGCTGCAGCCGGG + Intergenic
1143834987 17:9684466-9684488 TAAAATATTCAGCATCAGCTTGG + Intronic
1143910746 17:10246760-10246782 AAAAAAACTCAGCTGAAGATGGG - Intergenic
1144749086 17:17635823-17635845 AAAAATACTTAATTCCAGCTGGG + Intergenic
1146556329 17:33827637-33827659 AATAAGAGTGAGCTGCAGCTGGG - Intronic
1147024823 17:37572130-37572152 AAACATATTCAAGTGCAGCTGGG + Intronic
1147851886 17:43450099-43450121 AAAAACCCACAGCTGCTGCTAGG - Intergenic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1149247890 17:54733074-54733096 AAAAATACTCAACATCAGCCAGG + Intergenic
1149322309 17:55493827-55493849 AAAAAAAAGCAGCAGCAGCTTGG + Intergenic
1149554715 17:57565163-57565185 AAAAATCCTTAGATGCAGATGGG - Intronic
1150195452 17:63293624-63293646 AAATATAAACAGCTGCAGCTAGG - Intronic
1150730086 17:67685263-67685285 AAGAATGCTAAGCAGCAGCTTGG - Intronic
1150921952 17:69493463-69493485 AAAAATACTCAGCTGCAGCTGGG + Intronic
1151116115 17:71737004-71737026 AAAATTCCTCATCTGCAACTTGG - Intergenic
1151275169 17:73028820-73028842 AAAAAAACACTGCTGCAGCCGGG + Intronic
1151298773 17:73205906-73205928 AATGATACTCAGCAGCTGCTAGG - Intronic
1152154741 17:78625541-78625563 AAAAACACTCTGTTCCAGCTGGG - Intergenic
1153222530 18:2874348-2874370 AAAAGTAATCAACTACAGCTGGG - Intronic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1156276518 18:35588692-35588714 AAAAAGACTCAGCAGCAGAAAGG - Intronic
1156711394 18:39950579-39950601 AAAAATAGAGAGCTTCAGCTGGG - Intergenic
1156795132 18:41035400-41035422 AAAACTACTCAGCTGCGGCTGGG - Intergenic
1157680810 18:49604187-49604209 AAGAATACTCAGCTGGTGCTTGG + Intergenic
1157754739 18:50207631-50207653 AAAAATATACAGCTGGGGCTGGG - Intergenic
1158747425 18:60217640-60217662 AAAAATGCTCATCTGAAGATAGG - Intergenic
1161673552 19:5628255-5628277 AAAAAGAATCAGCTGAAGCTGGG + Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1163856193 19:19704191-19704213 TAAAATACACAGCCACAGCTAGG + Intergenic
1164096509 19:22014848-22014870 AAAAATAAACAGCATCAGCTGGG - Intergenic
1166066751 19:40364494-40364516 AAAAAAAATTAGCTGCGGCTGGG + Intronic
1166821378 19:45582453-45582475 AAAAAAACTCTGCTCCAGCTGGG - Intronic
1168482450 19:56733089-56733111 AAAAATATTCACCTGCTTCTTGG - Intergenic
1168493250 19:56829053-56829075 CTAAAAAGTCAGCTGCAGCTGGG + Intronic
925748070 2:7061341-7061363 ATAAATATTCAGCTGAAGCCTGG - Intronic
927138237 2:20112886-20112908 GGAAACACTCAGCTTCAGCTGGG - Intergenic
928374952 2:30766428-30766450 CAAAACACCCAGCTGCTGCTGGG - Intronic
929872467 2:45770748-45770770 AGAAATAATCCGCTGCAGATGGG - Intronic
930974139 2:57433916-57433938 AAAAGTAATCAGCTCCAACTTGG - Intergenic
931955739 2:67422139-67422161 AAAAATACTTTATTGCAGCTGGG - Intergenic
932033134 2:68211109-68211131 AAAAATACTCCATTGCGGCTGGG + Intronic
933058524 2:77704693-77704715 AAACCTACTCATCTGCTGCTTGG - Intergenic
933203042 2:79472501-79472523 AGAAATATTCAGCTGCAAATGGG - Intronic
934079501 2:88455503-88455525 AAAAATAGACAGTTGCAGATCGG + Intergenic
937154940 2:119712272-119712294 AAATATACTCTGCTGCTGTTGGG - Intergenic
939869583 2:147511908-147511930 AAATTTACTCTGCTGTAGCTTGG - Intergenic
941098529 2:161270504-161270526 CATAATACTCAGCTGAAGGTAGG - Intergenic
942403663 2:175630122-175630144 AAAAATAATCAGCGGCAACAGGG + Intergenic
943277878 2:185891264-185891286 TAAAATCCTCAGCTTCAGCCAGG - Intergenic
944772800 2:202931609-202931631 AAAGACACTCACCTGCAGTTGGG + Intronic
945268723 2:207917219-207917241 AAATTTCATCAGCTGCAGCTGGG - Intronic
946317366 2:218925805-218925827 AAAAAAAATCAGCTGCATTTTGG + Intergenic
947982512 2:234422433-234422455 AAACACACCCAGCTGAAGCTTGG - Intergenic
1169548900 20:6681008-6681030 CAAAAGCCTCAGCTGCAGCCTGG - Intergenic
1172243093 20:33426463-33426485 AAAAAGATTCAGCTGCAGGTTGG + Intronic
1172589903 20:36110355-36110377 AAACAGAATCAGCTCCAGCTTGG - Intronic
1173442511 20:43090561-43090583 AAAAATAGTCACCTGTGGCTGGG - Intronic
1173550510 20:43930001-43930023 AAAAATACTCAGAAGCAGCTGGG - Intronic
1174309936 20:49644379-49644401 AGAAAAGCTCAGCTGCAGCCAGG - Intronic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176894426 21:14359828-14359850 TGAAATACTCAGCTGAAACTGGG + Intergenic
1177788604 21:25697604-25697626 AAAAATACTCAGGTTTGGCTGGG + Intronic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1179142070 21:38734414-38734436 AAAATCACTCAACTGCCGCTCGG + Intergenic
1182886803 22:33780766-33780788 AAAAGTTCTTAGCTGCAGCAAGG - Intronic
1184268869 22:43366159-43366181 AACCTTCCTCAGCTGCAGCTTGG + Intergenic
1184907275 22:47497371-47497393 TGAGATACTCAGCTGCTGCTTGG + Intergenic
951366245 3:21786709-21786731 AAAATTACTTAGATGCAACTTGG - Intronic
951994552 3:28712986-28713008 AAAAATTCTCTGCTTGAGCTGGG - Intergenic
952868978 3:37880950-37880972 AAAAATGCTCAGCTACACCATGG + Intronic
954488361 3:50876534-50876556 TAAAATATTCAGCTGCATTTGGG + Intronic
954852285 3:53613719-53613741 AGAAATACCCAGCTTCTGCTTGG + Intronic
955342312 3:58134544-58134566 AAGAAAAGTCAGATGCAGCTGGG + Intronic
956037698 3:65113139-65113161 AAAAATGCTGAGCAGGAGCTAGG - Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
960390434 3:117071504-117071526 AAAAATAATCAGCTATGGCTAGG + Intronic
961237205 3:125377092-125377114 AAAACTTCTCAGCTTCAGGTTGG + Intergenic
961803685 3:129473003-129473025 TAAAATTCTCATCTGCAGCTGGG + Intronic
964800623 3:160553348-160553370 AAAAACAATCTGCTTCAGCTTGG + Intronic
966056524 3:175699150-175699172 AAATTTGCTCAGCTGAAGCTTGG - Intronic
966611912 3:181875936-181875958 GAAAATTCTCAGCTGGAGCCTGG - Intergenic
967638288 3:191831206-191831228 AAAAAGAAGCAGCAGCAGCTAGG + Intergenic
969231868 4:5837793-5837815 AAATATACTCCTCTGCATCTAGG - Intronic
974042773 4:56871780-56871802 AACATTACGCAGCTGCAGCTGGG + Intergenic
974396436 4:61342155-61342177 AAAAACCCTCAGCAGCAGCAAGG - Intronic
974955252 4:68631497-68631519 AAAAATACACAGCTGCTACTCGG - Intronic
976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG + Exonic
977304599 4:95306852-95306874 AAATATACAAAGCTGCAGGTTGG + Intronic
977757486 4:100690369-100690391 AAAAATAATAAATTGCAGCTGGG + Intronic
977783839 4:101009712-101009734 AAAGATACTCTGCTGGGGCTTGG - Intergenic
977814832 4:101403054-101403076 ATAAATACAAAGCTGCAGCTAGG + Intergenic
978540318 4:109809601-109809623 AAAAGTACTTAGCTGAAGCTAGG - Intergenic
979815983 4:125104632-125104654 AAAAATAAACAGCTGCAGAAAGG + Intergenic
981980647 4:150786934-150786956 AAAAATACTCAGATTCGGCCAGG + Intronic
982292437 4:153792494-153792516 AAAAATACTCACCCGGAGCAGGG - Intergenic
983079152 4:163364176-163364198 AAAAATAGGCAGATGCGGCTGGG + Intergenic
983092678 4:163523385-163523407 TATAATACTTAGCTGCAGCATGG + Intergenic
983913058 4:173261519-173261541 AAAAATAGATAGCTACAGCTGGG + Intronic
983958841 4:173728019-173728041 AAAAAAACAAAACTGCAGCTAGG + Intergenic
984113168 4:175645107-175645129 AAAAATAATAAGCTGAAACTAGG + Intronic
984135949 4:175939231-175939253 AATACTACTCAGCTGCTGCAGGG + Intronic
986401927 5:7390821-7390843 AAAATAAATCAGCTGAAGCTTGG + Intergenic
986609314 5:9551127-9551149 AAAAAAACTCCCTTGCAGCTAGG + Intergenic
989404107 5:41041329-41041351 AAAAATACACATCTTCAGCGGGG + Intronic
990634111 5:57704671-57704693 AGAAATAGTCAGTTGCAGCATGG - Intergenic
990752197 5:59029115-59029137 AAAAATACTTAGGAGCAGCCAGG + Intronic
990835521 5:60014980-60015002 AAAAATTCTGAGATCCAGCTGGG - Intronic
991905034 5:71501108-71501130 AAAAATTCTCATCTGCATTTAGG + Intronic
992500689 5:77339709-77339731 ATACATATTTAGCTGCAGCTGGG - Intronic
992549969 5:77850917-77850939 ATAAATACTGAGCTGGGGCTGGG - Intronic
993220294 5:85087013-85087035 AAACATACTCAGCTCTGGCTGGG + Intergenic
993604167 5:89967303-89967325 AAAAACACTCAGCTGTAGTGTGG - Intergenic
994149407 5:96431596-96431618 CAAAAGACTCATCTGCTGCTGGG + Intronic
994862092 5:105209834-105209856 AAAAAAACACAGCTGAAGCATGG - Intergenic
995768190 5:115641109-115641131 AAAATTCCTCATCTGTAGCTTGG - Intergenic
995949781 5:117696540-117696562 AAAATTACTCAGCTGCAAATAGG - Intergenic
997270828 5:132536318-132536340 TACTATACTCTGCTGCAGCTGGG - Intergenic
997950073 5:138235596-138235618 AAAAACATTCAGCTTCAGCTGGG + Intergenic
998899507 5:146838119-146838141 AAAAATAGTTATCTACAGCTTGG + Intronic
999290639 5:150423441-150423463 AATAATACTCAGCATGAGCTGGG + Intergenic
999769863 5:154767258-154767280 AAAAATACTCAACTGGAGCCTGG + Intronic
999771921 5:154782497-154782519 AAAGATAGTCAGCTGGGGCTGGG + Intronic
1000190718 5:158908059-158908081 AAAATTACTGAGCTGGAGTTTGG + Intronic
1000475020 5:161696392-161696414 AAAAAAAATCAGCTCCAGCCTGG - Intronic
1001620315 5:173078682-173078704 AAAAATACTCACCAGCACTTTGG - Intronic
1002488601 5:179557618-179557640 TCAAATACTTAGCTGCAGTTTGG + Intronic
1002891877 6:1340410-1340432 GAAAATACGCAGCTGAGGCTAGG - Intergenic
1003264366 6:4552500-4552522 AAAAATCCTCAGCAGCTTCTTGG - Intergenic
1003993986 6:11519853-11519875 AATAATACCCAACTGCAGGTCGG + Intergenic
1004232320 6:13844743-13844765 AAAAATACTCAGGGGCGGCCCGG + Intergenic
1005251606 6:23952443-23952465 GTAAATCCTCAGCTGCTGCTTGG - Intergenic
1005386275 6:25288249-25288271 AAACATACTAAGGTACAGCTGGG + Intronic
1005953576 6:30648218-30648240 AAGAATATCCAGCTGAAGCTAGG - Intronic
1007273372 6:40655618-40655640 AAAGATGCTCAGCTGAAGCAGGG + Intergenic
1008939927 6:57035806-57035828 AAAAATACTTTACTGCAGCTGGG + Intergenic
1009638640 6:66300878-66300900 AAAAATACTCAGCAAAGGCTGGG - Intergenic
1012867076 6:104631620-104631642 AAAAATAATAATATGCAGCTTGG + Intergenic
1015111540 6:129597343-129597365 AAAAATTCTCATCTCCAGCCTGG - Intronic
1015741578 6:136460784-136460806 AAAAATCTTCAGATGCACCTTGG - Intronic
1017677275 6:156827170-156827192 AGACATAATGAGCTGCAGCTTGG - Intronic
1020206231 7:6119058-6119080 AAAAAAAATTAGCTGCATCTGGG + Intronic
1020231543 7:6322825-6322847 ATAAATAAAGAGCTGCAGCTGGG + Intergenic
1020368620 7:7408388-7408410 AAAAAGACTTATCTGCAACTAGG + Intronic
1021378785 7:19940940-19940962 AAAAACACCCAGCTGCTGCCTGG + Intergenic
1023062584 7:36342919-36342941 AAAATTACTCATCTGTGGCTGGG - Intronic
1024391459 7:48817757-48817779 AAAATCACTCAGCTGAGGCTGGG - Intergenic
1026369114 7:69680963-69680985 TAAAATACTCAAATTCAGCTGGG - Intronic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1028077871 7:86536811-86536833 AATAATAATTGGCTGCAGCTGGG - Intergenic
1028741099 7:94276741-94276763 AAAACTACTCTTCTGCTGCTAGG - Intergenic
1031321117 7:120329381-120329403 AAAAATACTAAGCTACATATTGG - Intronic
1031608728 7:123799999-123800021 AAAAATACAAAGCATCAGCTAGG + Intergenic
1031978590 7:128109378-128109400 ACATATACACAGCTGCTGCTGGG - Intergenic
1032527433 7:132589955-132589977 GAAAATACTCAGTTCCAGGTGGG + Intronic
1038568215 8:28637415-28637437 AAACTTACTCAGATGCACCTGGG - Intronic
1038689537 8:29748677-29748699 AAAAATACTAATCATCAGCTGGG + Intergenic
1039038211 8:33382718-33382740 GACAATACTCAGCTGCTGCTGGG - Intronic
1039634287 8:39146025-39146047 AAAAATACTCTGAAGCAGCCAGG - Intronic
1040082127 8:43296736-43296758 AAAAAGACTAAGCAACAGCTAGG + Intergenic
1040953274 8:52956548-52956570 TACAATACTAATCTGCAGCTTGG + Intergenic
1042842761 8:73140757-73140779 AAAAATGCTGAGCTGCATTTTGG - Intergenic
1043581609 8:81721506-81721528 AGAAATACCCACCTGCAGCCGGG + Intronic
1044762548 8:95536844-95536866 AAAAATACTGAGCTAGAACTTGG + Intergenic
1050440228 9:5654211-5654233 AAAAATACACACTTGCAGCCTGG - Intronic
1050717712 9:8548661-8548683 AAAAAAATCCAGCTCCAGCTGGG - Intronic
1051715878 9:19983347-19983369 AAAAAAACTCAGCTGTGGCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054780715 9:69163771-69163793 AAAAATAATTATTTGCAGCTGGG - Intronic
1056502681 9:87225285-87225307 ATAAATACGCAGCTTTAGCTGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058446883 9:105062595-105062617 AAAATTGTCCAGCTGCAGCTGGG - Intergenic
1059517538 9:114909701-114909723 AAAGATAGACAGGTGCAGCTGGG - Intronic
1061099664 9:128483186-128483208 AAAAATGCACAACTGCGGCTGGG - Intronic
1061245273 9:129398392-129398414 AGAAATCCCCAGCTGCTGCTGGG - Intergenic
1188379946 X:29479112-29479134 AAGAATATTCAGCATCAGCTGGG + Intronic
1191689618 X:63926391-63926413 AACCATACTCAGAAGCAGCTAGG - Intergenic
1192247988 X:69389021-69389043 AGAAATACTCAGCTGAAGCCAGG + Intergenic
1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG + Intergenic
1194157034 X:90404094-90404116 AAAAATACTCTGCCTCGGCTTGG - Intergenic
1194880358 X:99243112-99243134 AAACCTACTCAGATGGAGCTGGG - Intergenic
1196593309 X:117514058-117514080 AGAACAACTCAGCTGAAGCTGGG + Intergenic
1196820412 X:119696185-119696207 AGCAATTCTCTGCTGCAGCTGGG + Intergenic
1198380662 X:136080268-136080290 AAAAATAATGAGCTGGGGCTGGG + Intergenic
1198433423 X:136590920-136590942 CAAGATACTCAACTGCAGCCTGG + Intergenic
1198804996 X:140485325-140485347 AAAAATTCTAAGTGGCAGCTGGG + Intergenic
1199839470 X:151629921-151629943 AAAAATATTCTGATGCAGCAAGG + Intronic
1201768225 Y:17592918-17592940 AAAAAGACTCAGGTCCAGGTGGG - Intergenic
1201833328 Y:18313067-18313089 AAAAAGACTCAGGTCCAGGTGGG + Intergenic