ID: 1150923069

View in Genome Browser
Species Human (GRCh38)
Location 17:69504057-69504079
Sequence ACCTGGATTCTGATTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150923066_1150923069 -5 Left 1150923066 17:69504039-69504061 CCACCTGGGTGTCAGGAGACCTG 0: 1
1: 0
2: 4
3: 41
4: 226
Right 1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG 0: 1
1: 1
2: 0
3: 23
4: 146
1150923068_1150923069 -8 Left 1150923068 17:69504042-69504064 CCTGGGTGTCAGGAGACCTGGAT 0: 1
1: 1
2: 14
3: 62
4: 342
Right 1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG 0: 1
1: 1
2: 0
3: 23
4: 146
1150923065_1150923069 -4 Left 1150923065 17:69504038-69504060 CCCACCTGGGTGTCAGGAGACCT 0: 1
1: 1
2: 5
3: 43
4: 308
Right 1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG 0: 1
1: 1
2: 0
3: 23
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150923069 Original CRISPR ACCTGGATTCTGATTCTGAC TGG Intronic
900086354 1:899640-899662 ACCAGGATGCTGATTCTGAAAGG + Intergenic
901053710 1:6438749-6438771 GACTGAATTCTGATTCTGGCAGG + Intronic
902480592 1:16709582-16709604 GACTGAATTCTGATTCTGGCAGG - Intergenic
902544177 1:17176527-17176549 AGCTGGACTTTGATTCTCACTGG + Intergenic
905308939 1:37036471-37036493 GCCTGGATGCTAATTCTGCCTGG + Intergenic
905362532 1:37430558-37430580 ATCTGGAGTCAGATTCTGAGGGG + Intergenic
905627029 1:39495889-39495911 GCCTGCATTCTGATCCTGGCTGG - Intronic
905669906 1:39784882-39784904 GCCTGCATTCTGATCCTGGCTGG + Intronic
907406554 1:54257125-54257147 ACCTGGTTTCCCATTCTGATCGG + Exonic
907462864 1:54615648-54615670 GCCTGGATTCTGACTGTGACTGG + Intronic
910631897 1:89364172-89364194 ACTTGGTTTCTGATTCAGAGTGG + Intronic
912083094 1:105962712-105962734 ACCTGGATTCTGATGTTCAAGGG - Intergenic
915437198 1:155916675-155916697 ACCTTCAATCTCATTCTGACTGG + Exonic
915755169 1:158252396-158252418 AGCTGAATTCTTATTCTTACTGG + Intergenic
916173667 1:162020803-162020825 ACCTGGATTCTGATTGGGTGCGG - Intronic
916960734 1:169885977-169885999 CACTGGATTCTGATTATGAAGGG + Intronic
917993732 1:180412086-180412108 GCCTGTATTTTGATTCTGAAAGG + Intronic
922480428 1:225936896-225936918 ACCTGGATTCTGGTTCTGACAGG - Exonic
923667719 1:236013741-236013763 ACCTGGGTTCTGCCTCTGATGGG + Intronic
1063010220 10:2014278-2014300 AACTGGATTCTCATTTTGTCTGG + Intergenic
1063909014 10:10810919-10810941 TCCTGGATCCTTATTCTGAGTGG - Intergenic
1064018534 10:11791419-11791441 ACCTGGATTCTGGTTCTACGTGG - Intergenic
1066285738 10:33964395-33964417 AACTGGATACTGATTATGGCTGG - Intergenic
1066317341 10:34260909-34260931 AACCGGATTCTGATTTTAACGGG + Intronic
1067567808 10:47350907-47350929 ACCTGTATTCTGTCTTTGACAGG + Exonic
1067980564 10:51079592-51079614 ACCAAGATTCTCATTCTCACTGG - Intronic
1069573010 10:69505957-69505979 CCCTAGATTCTGATTCTTAATGG - Intronic
1070072917 10:73107081-73107103 ACCTGGATTGTATCTCTGACTGG - Intergenic
1070786011 10:79162594-79162616 ACCTGGATTCAAATCCTGACTGG + Intronic
1071338732 10:84623256-84623278 ACCAGGTTTCTGATTTTGAAAGG + Intergenic
1071851957 10:89581742-89581764 AACAGGATACTGACTCTGACAGG - Exonic
1071953291 10:90729088-90729110 ACTGGGATTCTGTTTCTTACAGG - Intergenic
1074099492 10:110343092-110343114 ACCTGGATGCTGATTTTTAGGGG - Intergenic
1074262073 10:111864012-111864034 ACCTGGTTTCTGATTCTACCTGG + Intergenic
1079905525 11:26241846-26241868 CCCTGGATTCAGATACTGCCTGG - Intergenic
1081962052 11:47145291-47145313 GCCTGCATTCTTATTCTGGCTGG + Intronic
1082732680 11:56819466-56819488 ACGTGAGTACTGATTCTGACAGG - Intergenic
1085836660 11:79963824-79963846 TCCTGCATTTTCATTCTGACTGG - Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1093882891 12:24425839-24425861 ACCTGAATTCTAATTCTGCCTGG - Intergenic
1096423268 12:51478798-51478820 ATCAGGATTCTGGTTGTGACTGG + Intronic
1097958218 12:65507798-65507820 ATCTGTATTCTGATTTTGTCTGG + Intergenic
1098425669 12:70363838-70363860 ACCTGTATTCTGAAACTGAGGGG + Intergenic
1098448539 12:70592807-70592829 GCCTGGATTCTGGTTCAGACTGG + Intronic
1099273149 12:80538922-80538944 ACCTGCATTCAAATTCTGTCAGG - Intronic
1101385796 12:104256435-104256457 AACTGAATTCAGATTCAGACTGG + Intronic
1102204545 12:111081595-111081617 AAGGAGATTCTGATTCTGACTGG + Intronic
1102229431 12:111252360-111252382 ACCTGGGTTCTGGTTTTAACTGG - Intronic
1103151381 12:118641937-118641959 ACTTGGCTTCTGATTTTGAGGGG + Intergenic
1105573668 13:21628172-21628194 AGATGGATTCTGATCCTGTCTGG + Intergenic
1109774557 13:67022925-67022947 CCCTGGATACTGAGTGTGACAGG + Intronic
1110563425 13:76934275-76934297 ACATGGATTCTGATTCTGTAGGG + Intergenic
1112185163 13:97120981-97121003 ACTGGGATTCTGATTCTCTCTGG - Intergenic
1117287611 14:54302077-54302099 ACCTGCACTCTGCTTCTGCCTGG - Intergenic
1121729281 14:96175184-96175206 ACCTGGAAGCTGATTATGGCTGG - Intergenic
1125470182 15:39994694-39994716 GCCTGGGTTTTGGTTCTGACAGG + Intronic
1127430392 15:58901434-58901456 ACATGGACTCTGGTTCTGATTGG - Intronic
1130161642 15:81407564-81407586 CCCTGGGCTCTGATTCTGAAGGG - Intergenic
1133903895 16:10003233-10003255 TCCTGGATTCTGATTCCAATGGG + Intronic
1134588926 16:15435821-15435843 AACTGTGTTCTGATTCTGACGGG + Intronic
1134647171 16:15878277-15878299 ACCTGATTTCTGATTATGCCTGG - Intronic
1134847560 16:17453266-17453288 GCCTGTCTTCTGATTCTGCCTGG - Intronic
1136369128 16:29825071-29825093 ACCTGGTTTCTGCTTTGGACAGG + Intronic
1137060185 16:35786582-35786604 ACCTGGATCTGGATTCTCACAGG + Intergenic
1138303463 16:55953256-55953278 ACCTGGTTTCTGATTTTAAAAGG - Intronic
1139286227 16:65816908-65816930 ACCTGGATTCAAATCCTGATGGG - Intergenic
1139302003 16:65953289-65953311 AACTGGACTCCGATTCTGGCTGG - Intergenic
1142941513 17:3383510-3383532 ACCTGGATTTTCATCCTGACTGG - Intergenic
1143291678 17:5836149-5836171 CCCTGGATTCTGTTTGTGAAAGG + Intronic
1144205845 17:12979062-12979084 ACCTGGATTCTGATGCCCACAGG - Intronic
1146512008 17:33458020-33458042 AAGGGGATTCTGATTCTGACAGG + Intronic
1146530524 17:33604212-33604234 ATCTGGATTCTAATTCTGAATGG - Intronic
1147728497 17:42581882-42581904 ACCTGGACACTGATGCTGAGGGG - Exonic
1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG + Intronic
1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG + Intronic
1153114535 18:1639323-1639345 TTCTGCCTTCTGATTCTGACAGG - Intergenic
1157169164 18:45386226-45386248 ACCTGGAATCTACTTCTGGCTGG + Intronic
1162136647 19:8559454-8559476 ATCTGGGTTCTGATCCTGACTGG + Intronic
1163159487 19:15456400-15456422 ACCTGGATTCTGGTAGTGAGTGG - Intronic
1164572985 19:29387483-29387505 ACCTGGTTTCTGTATCTGCCAGG + Intergenic
1167886120 19:52501361-52501383 GCAGGGATTCTTATTCTGACGGG + Intronic
1167888100 19:52518459-52518481 GCAGGGATTCTTATTCTGACGGG + Intergenic
1167912608 19:52716355-52716377 GCAGGGATTCTTATTCTGACGGG - Intronic
1167922320 19:52792019-52792041 GCAGGGATTCTTATTCTGACGGG - Intronic
1168646420 19:58061747-58061769 ACACGGATTCTGATTCTACCAGG + Intronic
1202714634 1_KI270714v1_random:35490-35512 GACTGAATTCTGATTCTGGCAGG - Intergenic
927018790 2:18996501-18996523 GCCTGGATTCTTTATCTGACTGG - Intergenic
927684803 2:25162899-25162921 CCCTGTAATCTCATTCTGACTGG + Intronic
928541164 2:32284789-32284811 ACCTGGATTCTGTTTGTCTCAGG - Intronic
929513288 2:42582930-42582952 ACCTGGGTTCAGATTCTGGTTGG + Intronic
931701437 2:64912500-64912522 ATCTGGATTCCCATTCTGTCAGG - Intergenic
932266206 2:70369026-70369048 ACCCGGATCCTGTCTCTGACAGG + Intergenic
933507086 2:83191176-83191198 CACTGGATTATGTTTCTGACAGG - Intergenic
935428478 2:102946619-102946641 GCCTGGATTCAGATCCTGGCTGG + Intergenic
936237364 2:110754467-110754489 ATGGGGATTCTGATTCTGAAGGG - Intronic
938707194 2:133942470-133942492 ACCAGTATTCTGATTCTGTGGGG - Intergenic
940192241 2:151054271-151054293 ACCTGGATTTTTATTTTGACTGG - Intergenic
943580201 2:189674926-189674948 ACGTGGGTTCTGTTTCTGAAAGG + Intronic
944511669 2:200471784-200471806 TCCTGTATTGTGATTCTTACTGG + Intronic
945092562 2:206189309-206189331 ACATGTATTTTGCTTCTGACCGG + Intronic
947413323 2:229866874-229866896 GCCTGTATTCTGCTTTTGACTGG - Intronic
1168904700 20:1393617-1393639 CCCTGGATTCTGATTCCGTTGGG - Intergenic
1169468351 20:5861190-5861212 ACCTGCAATCTTATTCTGAAAGG - Intronic
1169680892 20:8212435-8212457 CCCTGGAGTAAGATTCTGACAGG + Intronic
1172079033 20:32324400-32324422 ACCCGGAGTCTGATTCAGAAAGG + Intronic
1174893011 20:54418546-54418568 ACCTGGAGTCTGATGCTCAAGGG + Intergenic
1175719330 20:61275782-61275804 TCCTGGATTCTGAGTATCACTGG + Intronic
1175740197 20:61414713-61414735 ATCGGAATTCTGATTCTGAGAGG - Intronic
1176297848 21:5083714-5083736 ACCTGGATTCTGAACCAGCCTGG + Intergenic
1179859181 21:44178235-44178257 ACCTGGATTCTGAACCAGCCTGG - Intergenic
1181150206 22:20877869-20877891 ACTTGGCTTCTGAGTCTGCCTGG - Intronic
1184191088 22:42895001-42895023 ACCAGGATTCTGGTTCTCACAGG - Intronic
949833780 3:8245873-8245895 ACCTAGATTCTGGCTCTGATAGG - Intergenic
950169456 3:10827931-10827953 TCCTGGATTCTGACTCTTATGGG + Intronic
952131764 3:30372166-30372188 ACATGGATTCTAATTCTGAAGGG + Intergenic
956314248 3:67916337-67916359 TCCTGGATTCTTACTCTGATTGG - Intergenic
961957571 3:130819585-130819607 AAGTGGATCCTGATTCTTACAGG - Intergenic
962265771 3:133943204-133943226 CCCTGGGTTCTGATTCTGTCAGG + Intronic
962576452 3:136759427-136759449 ACCAGGTTACTGATTCTGAAAGG - Intergenic
963066026 3:141265372-141265394 ACCAAGATTCTGATTCTGTAAGG - Intronic
964215912 3:154282033-154282055 ACCTGAATTCATATCCTGACTGG + Intronic
964699630 3:159551206-159551228 ACCTGAATTCAGATACTGATGGG - Intronic
968657942 4:1786700-1786722 AGGTGGCTTCTGTTTCTGACAGG + Intergenic
978446736 4:108787474-108787496 ACCTGGATCCTGCCTCTCACGGG - Intergenic
980184469 4:129444942-129444964 AACTGAATTCTAATTCTCACAGG + Intergenic
980384240 4:132065498-132065520 ACCTTGGTTCTAACTCTGACTGG - Intergenic
984417478 4:179479657-179479679 ATCTGGATTCTGACACTTACTGG - Intergenic
984658411 4:182345533-182345555 ACCTATATTTTGATTCTGATTGG + Intronic
984829148 4:183955011-183955033 TCCTGGATTCTCATTCTCAGAGG + Intronic
986468312 5:8049420-8049442 ACCTGGTTTCTGCCTCTGAGGGG - Intergenic
988208841 5:28176012-28176034 AACTGAATTCTGATTCTGTTTGG - Intergenic
991085580 5:62645738-62645760 ACCTGTCCTCTGATTCTCACAGG + Intergenic
991392390 5:66160420-66160442 ACCTGCATTCTGATTCTTGGGGG + Intronic
992181952 5:74206242-74206264 ACCTCCATTCTGACTCTGGCAGG + Intergenic
993296488 5:86147713-86147735 ACCTGGAGTCTGATGTTGAAGGG + Intergenic
994599356 5:101882491-101882513 ACCTAGATTCACATTTTGACTGG - Intergenic
994763547 5:103887125-103887147 ACCTGGATACTAATTCTGAATGG - Intergenic
995091882 5:108187743-108187765 AGCTGGATTGTGTTTCTGAAGGG - Intronic
1004299683 6:14445902-14445924 ACCTGGGTTCAAATTCTGACTGG - Intergenic
1008129004 6:47699556-47699578 ATCTGGATTCAGATTCTGATAGG - Intronic
1008180366 6:48320674-48320696 ACGTGGTTTCTGTTTCTTACTGG - Intergenic
1008630708 6:53360698-53360720 ACCTGGATACAGAATCTGCCTGG + Intergenic
1008659455 6:53651590-53651612 ACCTGGGCTCAGATACTGACTGG + Exonic
1010987964 6:82447311-82447333 ACCTGGATTCTGATACACAGAGG + Intergenic
1011699027 6:89938384-89938406 AGCTGGATTTTAATTCTGGCAGG + Intronic
1012326225 6:97921460-97921482 ACCTGGAGTCAGCTTCTGATGGG + Intergenic
1012868175 6:104642750-104642772 ACCTGGATCCTCCTTCTCACAGG + Intergenic
1018442916 6:163829738-163829760 ACCAGGATTGTGATCCTGCCAGG + Intergenic
1019845420 7:3494992-3495014 ACCAGGTTTATGGTTCTGACAGG - Intronic
1020977630 7:15026548-15026570 CCCTGGATTTTGTATCTGACGGG + Intergenic
1021587851 7:22228832-22228854 GCCTGGATTCTTTTCCTGACTGG - Intronic
1023088660 7:36597691-36597713 ACTAGGTTTCTGATTCTGTCTGG + Intronic
1027485933 7:78761755-78761777 ACCTAGATTCAGATTCTGTAAGG + Intronic
1030265991 7:107622448-107622470 ACCTGCATTCTGATTCTTCTTGG + Exonic
1032274571 7:130442934-130442956 CCCTCAATTCTGATTCTGGCCGG + Intergenic
1032900867 7:136305830-136305852 ACCTGGTAACTGATTCAGACTGG - Intergenic
1033151992 7:138923078-138923100 ACCTGGCTTCTAATTCTGTCAGG - Intronic
1034964860 7:155384627-155384649 ACCTGGATTCTGGTTCAGGGCGG - Intronic
1035093219 7:156331437-156331459 ACCTGGAGACTGATTCTGTTTGG + Intergenic
1035633104 8:1123395-1123417 TCCTGGTGTCTCATTCTGACCGG - Intergenic
1039848155 8:41340885-41340907 ACCTAGAGTCTGAATGTGACTGG + Intergenic
1040565787 8:48565530-48565552 CCCTGGAGTCTGATGCTCACAGG + Intergenic
1046633091 8:116641329-116641351 ACTTGCATTCTTATTCTTACAGG - Intergenic
1047720081 8:127631000-127631022 GCCTGGATTCAAATTCAGACGGG - Intergenic
1048143190 8:131815711-131815733 CTCTAGATTCTGGTTCTGACTGG + Intergenic
1052353228 9:27478289-27478311 ACGTGGCTTCTCCTTCTGACTGG - Intronic
1189726707 X:43974785-43974807 AGGTGGATTCTGTTTGTGACTGG - Intergenic
1191113066 X:56822591-56822613 ACCTGGATTCTGAGTCTACAGGG - Intergenic
1201466720 Y:14289615-14289637 ACCTGGGTTCAAATTCTGACTGG + Intergenic
1201558833 Y:15293121-15293143 ACCTGGGTTCTCATTCTGGTTGG + Intergenic
1202098736 Y:21282429-21282451 ACATGGATTTTGTTTCTGCCTGG + Intergenic