ID: 1150924860

View in Genome Browser
Species Human (GRCh38)
Location 17:69522209-69522231
Sequence AATAATAGGCACACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150924860_1150924865 18 Left 1150924860 17:69522209-69522231 CCTTCCACAGTGTGCCTATTATT 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1150924865 17:69522250-69522272 AAATTGGAAAAATAGGATGAAGG 0: 1
1: 0
2: 6
3: 48
4: 567
1150924860_1150924863 2 Left 1150924860 17:69522209-69522231 CCTTCCACAGTGTGCCTATTATT 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1150924863 17:69522234-69522256 TAGTTGTTATTATTAAAAATTGG 0: 1
1: 0
2: 8
3: 91
4: 859
1150924860_1150924864 11 Left 1150924860 17:69522209-69522231 CCTTCCACAGTGTGCCTATTATT 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1150924864 17:69522243-69522265 TTATTAAAAATTGGAAAAATAGG 0: 1
1: 0
2: 17
3: 213
4: 1807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150924860 Original CRISPR AATAATAGGCACACTGTGGA AGG (reversed) Intronic
910604179 1:89065589-89065611 AATAATAGACACACTCTCAATGG + Intergenic
913086959 1:115447851-115447873 TATCATAGGCACACAGTGAAAGG - Intergenic
913178803 1:116299358-116299380 AACAATAGGAACACTTTAGACGG + Intergenic
913417191 1:118621601-118621623 AAAAATAGGCAAAATGTGGCCGG - Intergenic
914893144 1:151645848-151645870 AAAAGCAGGCAGACTGTGGAGGG - Intronic
917484835 1:175446364-175446386 AATAATAGCCATTTTGTGGATGG - Intronic
919042302 1:192405803-192405825 CTTAAGAGCCACACTGTGGAAGG + Intergenic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
919424166 1:197408448-197408470 AATAAAAGCCAGATTGTGGAGGG + Intronic
919584525 1:199419678-199419700 AATAATAGCCATTCTGGGGAGGG - Intergenic
919991833 1:202712666-202712688 AATAATAGGCTGGGTGTGGAGGG - Intergenic
920169428 1:204061546-204061568 AACAACAGGAACACAGTGGAAGG - Intergenic
920292668 1:204934866-204934888 AAAAATATGGGCACTGTGGACGG + Intronic
921841120 1:219829753-219829775 AACAAAAGGAACACTGAGGAGGG + Intronic
922982881 1:229842987-229843009 AATCATAAGGACACTGTGGGAGG - Intergenic
1063113366 10:3055306-3055328 AATAATAGGCATAATTTTGAAGG - Intergenic
1065207616 10:23372287-23372309 CATAATATGCACCCTGAGGATGG - Intergenic
1068723862 10:60278625-60278647 TATATTTGGCACACTTTGGAAGG - Intronic
1069323108 10:67198431-67198453 AATATGAGTCACAGTGTGGAAGG + Intronic
1072738830 10:97897225-97897247 AATTATAGGCAGCCTGGGGAAGG + Intronic
1073701633 10:105934255-105934277 GGTAATAGGCAGAGTGTGGAGGG + Intergenic
1074728118 10:116336314-116336336 AATAATAAGGCCACTGTGGCTGG + Intronic
1076986833 11:243432-243454 AATAATAAGACCATTGTGGAAGG - Intronic
1076986844 11:243548-243570 AATAAGAAGACCACTGTGGAAGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1084415709 11:69031894-69031916 TATAAAAGCCACAGTGTGGATGG + Intergenic
1085364407 11:75926142-75926164 TATATTAAGCACACTCTGGAGGG - Intronic
1087826904 11:102775530-102775552 CATAATATGCACACTGTTTATGG - Intronic
1087839958 11:102910267-102910289 AGGAATCGCCACACTGTGGAAGG - Intergenic
1088422832 11:109667975-109667997 AGAAAAAGACACACTGTGGATGG + Intergenic
1089043218 11:115473997-115474019 AAAAATAGGCAAAATATGGACGG + Intronic
1089084368 11:115804348-115804370 TATAAAAGGCCCACTGTGGTGGG - Intergenic
1091599105 12:1907367-1907389 AATAATAGGGGCACTGAAGATGG - Intronic
1093541510 12:20292288-20292310 AATAATAGGCACATTGACAAAGG - Intergenic
1094430512 12:30364157-30364179 AATAAAAAGCACACTGAGGCAGG - Intergenic
1098587468 12:72171083-72171105 GATAATAGGCACACTGAAAAGGG - Intronic
1099324002 12:81188847-81188869 AAGTATAGATACACTGTGGAAGG + Intronic
1100027013 12:90142572-90142594 AAAAATAGGCAGATTCTGGAGGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105962423 13:25354300-25354322 AACAGAAGGCAGACTGTGGAAGG + Intergenic
1106452829 13:29898827-29898849 AAGATTTGGCACACTGTGGATGG - Intergenic
1107236096 13:38172509-38172531 AATAATGGGAAGACTGTGTATGG - Intergenic
1109151626 13:58855828-58855850 AAAAAGAGTCACACTGTTGATGG + Intergenic
1109925371 13:69130399-69130421 AATAATAGTCACACTGTATTTGG - Intergenic
1110255512 13:73429524-73429546 AGTAATGAACACACTGTGGAGGG - Intergenic
1110539161 13:76688466-76688488 AATAATAGGCACATGGTGCATGG + Intergenic
1111898818 13:94175316-94175338 AATCATTGACACATTGTGGATGG - Intronic
1113201098 13:107867721-107867743 AATAAAAGTCAGACTGCGGACGG + Intergenic
1115738907 14:36366221-36366243 AATTATAGGTACACTGTGGTAGG + Intergenic
1118858883 14:69646302-69646324 TATAATGGGCATACTGAGGAAGG - Intronic
1120282469 14:82456776-82456798 AATAATATGCATACTATGGTGGG + Intergenic
1120552958 14:85893597-85893619 AATGACAGGCACTTTGTGGATGG - Intergenic
1124035027 15:26046756-26046778 ATTGATAGGAACACTGAGGATGG - Intergenic
1125320185 15:38478030-38478052 AATATTAGGCAAATTGTGAAGGG + Intronic
1125400273 15:39294997-39295019 AATAATAAGCTCTCTGTGGGAGG + Intergenic
1125574585 15:40746533-40746555 AAGAATAGGCTCCCTGTGGCTGG + Intronic
1130674756 15:85941829-85941851 AATAACAGGAAACCTGTGGAAGG - Intergenic
1131776203 15:95801820-95801842 AATACTGTGCACACTGTTGATGG - Intergenic
1132414113 15:101608478-101608500 CACAATAGGCACCCTCTGGAGGG - Intergenic
1135494851 16:22942432-22942454 AATAATAAACACAGAGTGGATGG + Intergenic
1135692568 16:24554311-24554333 AAAAATAGGCAGACTTTTGAGGG + Intronic
1138683675 16:58706037-58706059 AACCATGGGGACACTGTGGAGGG + Intergenic
1141396487 16:83709617-83709639 TTTAAGAGGCTCACTGTGGATGG - Intronic
1149147470 17:53513290-53513312 AAAAATAGGCAAACTGGGGAAGG - Intergenic
1149283078 17:55129748-55129770 AATAATAGGAGCATTGTGGTAGG + Intronic
1150248854 17:63695017-63695039 AGCAATAGGCACATTTTGGAGGG - Exonic
1150924860 17:69522209-69522231 AATAATAGGCACACTGTGGAAGG - Intronic
1151181501 17:72332309-72332331 AATATTGGGCACATTGTGAAAGG + Intergenic
1153106939 18:1538297-1538319 AAGAAAAGGCACACTGAAGAGGG - Intergenic
1153192622 18:2559025-2559047 AATGATAGAACCACTGTGGAAGG + Intronic
1155033864 18:22007632-22007654 AAAAAAAGGCACACTTTGGGAGG + Intergenic
1158238747 18:55351700-55351722 AATAATTGTCACACTGTGATAGG - Intronic
1161875100 19:6902376-6902398 AAAAAGAGGCACACAGTGGAGGG - Intronic
1162702436 19:12527188-12527210 ATGATTAGGCACACTGGGGATGG - Exonic
1163632386 19:18424107-18424129 AATAAAAGGACCAATGTGGAAGG + Intronic
1165824490 19:38698097-38698119 CAGAGCAGGCACACTGTGGAGGG + Intronic
1167742270 19:51330745-51330767 AAGGATAGGAACACTGTGAAGGG + Intergenic
1167924845 19:52813265-52813287 AAAAAAAGACATACTGTGGAAGG + Intronic
925516963 2:4693383-4693405 ATTAATAGTCTCACTGTGGTTGG + Intergenic
926493080 2:13549280-13549302 AATAATAGGGAAATTGTGGCTGG + Intergenic
928500187 2:31883614-31883636 AATAAAAGGCACATTTGGGAAGG + Intronic
930691117 2:54365763-54365785 AAAAATAGGCACATTTGGGAGGG + Intronic
935749285 2:106216170-106216192 AATACCAGGCACACTTTGGGGGG - Intergenic
941672760 2:168312221-168312243 TATAAAAGCCACACTGTGGAAGG - Intergenic
942783279 2:179671603-179671625 CATCATAGGCACACAGTAGAAGG + Intronic
944214823 2:197244471-197244493 AATATTAGGAACACTGTAAATGG - Intronic
947013696 2:225593763-225593785 ATTAATAGGCACACTTAAGAAGG + Intronic
1169566557 20:6859559-6859581 AAAAATAGGCACAAAGTGAATGG + Intergenic
1169605842 20:7318204-7318226 AATAAAAGGCATACATTGGAAGG - Intergenic
1171044136 20:21794643-21794665 AATAATGGTCAGACTTTGGAGGG - Intergenic
1183031101 22:35105272-35105294 CACAATAGCCACACTCTGGAAGG - Intergenic
1183130197 22:35826951-35826973 ATGAAAAGGGACACTGTGGATGG + Intronic
1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG + Intronic
1184700585 22:46169550-46169572 AATAACAGGGAAACTGTGGTGGG + Intronic
1184811306 22:46834390-46834412 AAGAATAGACACACTGAAGAGGG + Intronic
952038634 3:29234732-29234754 AATAATGGGGATACTGTGGGTGG + Intergenic
952047604 3:29342431-29342453 AATAATAGACACAATGGGTAAGG - Intronic
952529083 3:34244558-34244580 ATTAAATGTCACACTGTGGAAGG - Intergenic
953230525 3:41061134-41061156 AATAATATGAACACAGTGCACGG - Intergenic
953794126 3:45970106-45970128 AATAAGAGTCACACTGTGCTTGG + Intronic
954489107 3:50884811-50884833 AATAATAGGAAAACTGTGGGGGG - Intronic
956353765 3:68367697-68367719 AATAAAAGGCTCTCTGTGGTAGG + Intronic
957204529 3:77178654-77178676 AATTATATACACACTGTGGGGGG - Intronic
960511842 3:118558697-118558719 AATAATATGCATACTGTAGTGGG - Intergenic
960886939 3:122405616-122405638 ACTATTAGGCAGACTGAGGAAGG - Intronic
962817669 3:139017115-139017137 ATTAGTGGGCACACTGTGGGTGG - Intronic
962843682 3:139256992-139257014 AATAAGAGGCACAGAGTGGCCGG - Intronic
964890572 3:161529748-161529770 AATAAACGGGACACTTTGGAAGG + Intergenic
968251743 3:197222998-197223020 AATAGTAGGCACAGTGAGGCCGG - Intronic
971581979 4:28353136-28353158 GACAAAAGGCAAACTGTGGAAGG - Intergenic
971597260 4:28546624-28546646 ATTCCTAGACACACTGTGGAAGG + Intergenic
973594351 4:52470794-52470816 AATAGTAGGCATATTGAGGAGGG - Intergenic
973804487 4:54512625-54512647 AAATACAGGCAGACTGTGGAAGG - Intergenic
973903296 4:55500244-55500266 AGTAATAGGCAAACTGAGAAGGG - Intronic
975244739 4:72107040-72107062 AATCCTGGGCACACTGTGGTGGG - Intronic
979236994 4:118412208-118412230 AATAATCTGCAAACTGTGAAAGG + Intergenic
980588646 4:134854248-134854270 AATAATACAATCACTGTGGAAGG + Intergenic
984229383 4:177075652-177075674 AATAATAGGCAGACAGGGGCAGG - Intergenic
984833477 4:183998166-183998188 TATAATAGGCACACGTTGGAAGG + Intronic
986111902 5:4727631-4727653 AATAATAGGCAAACTGGGTGTGG - Intergenic
992860459 5:80904109-80904131 AATAACAGGCAGACTGGGGAGGG + Intergenic
993437469 5:87915827-87915849 AATAAAAGACACACTGAAGAGGG + Intergenic
995404000 5:111773749-111773771 AATATTAGGCACTCTGTAGAAGG - Intronic
997090541 5:130851288-130851310 AATAACAGGAAAACTGTGGAAGG + Intergenic
998612129 5:143700725-143700747 AATGATGGGTACACTGTGGAGGG + Intergenic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1008136640 6:47784756-47784778 AATAATAGTAAAAGTGTGGAAGG - Intronic
1010504495 6:76640638-76640660 AATAACAGGCATATTGAGGAGGG - Intergenic
1010621986 6:78088120-78088142 AGAAATATGCACATTGTGGATGG + Intergenic
1012132348 6:95513010-95513032 AACAGTAGGGACACTTTGGAGGG - Intergenic
1013817755 6:114119129-114119151 AAGAAGAGGCACACAGTGAATGG + Intronic
1017205524 6:151800812-151800834 AATGACAATCACACTGTGGAGGG - Intronic
1017246397 6:152231324-152231346 AAGAACAGGCACACTCTGTAAGG - Intronic
1018304798 6:162443840-162443862 ATTAAGAGGGTCACTGTGGAGGG - Intronic
1019749211 7:2718302-2718324 AAAACCAGGCACACTGTGGCGGG - Intronic
1022298639 7:29081617-29081639 AATAATAGACACAGAGTAGAGGG + Intronic
1022833128 7:34088227-34088249 AAGAAGTGGCCCACTGTGGAAGG - Intronic
1023178932 7:37461585-37461607 AATAATAAGCAATCTATGGAGGG + Intergenic
1024549938 7:50554292-50554314 AATAATAGGGCAACTGTGGGGGG + Intronic
1027767106 7:82358222-82358244 AACTACAGGAACACTGTGGATGG - Intronic
1037454829 8:19052821-19052843 AAAATCAGGCACACTGGGGAGGG + Intronic
1038508003 8:28102668-28102690 AATAATAGGGAAACTGGGGTAGG - Intronic
1039386568 8:37141329-37141351 AATAATGGGTACGCTTTGGATGG - Intergenic
1041335538 8:56778523-56778545 TATAATAGGTACTCTGTGGAAGG + Intergenic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1043197933 8:77323600-77323622 AATAATATGCTCTCTGTGAAAGG + Intergenic
1046730030 8:117714758-117714780 AATAATAGAGACAATGTGGAGGG - Intergenic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1050922334 9:11219921-11219943 AGTAAGTGTCACACTGTGGAGGG - Intergenic
1054933150 9:70657486-70657508 AATATTTGGTACACTGTAGAAGG + Intronic
1055058524 9:72045648-72045670 AAAAACTGGCACACTGTGGCCGG - Intergenic
1056043137 9:82688217-82688239 ATTTATAGGCTCACTGAGGAGGG - Intergenic
1057405799 9:94769718-94769740 AATTGTAAGCACACTGGGGAGGG + Intronic
1060569241 9:124623047-124623069 CTTATTTGGCACACTGTGGAGGG - Intronic
1062246932 9:135573908-135573930 AAAAATAGGTACACTGCGGCCGG - Intergenic
1187451510 X:19401020-19401042 AATTCTAAGCAAACTGTGGATGG - Intronic
1197113702 X:122806269-122806291 AAAAGTAGGCAGAATGTGGAAGG + Intergenic
1197810994 X:130442886-130442908 AATAATAGTCACAATTTTGAAGG + Intergenic
1198450329 X:136761017-136761039 AATAATAGAAACAGTTTGGATGG - Intronic
1198482038 X:137050399-137050421 GATAAAAGGCACAGTGTGGAGGG - Intergenic
1198928984 X:141831927-141831949 ATTAATAGACACACTCAGGAGGG - Intergenic