ID: 1150930686

View in Genome Browser
Species Human (GRCh38)
Location 17:69581496-69581518
Sequence CTGCAAACAGGTGTGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150930686_1150930690 0 Left 1150930686 17:69581496-69581518 CCCTCCAGCACACCTGTTTGCAG No data
Right 1150930690 17:69581519-69581541 AACTTCTTCCTCTCTTGCCCAGG No data
1150930686_1150930692 14 Left 1150930686 17:69581496-69581518 CCCTCCAGCACACCTGTTTGCAG No data
Right 1150930692 17:69581533-69581555 TTGCCCAGGCATTTTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150930686 Original CRISPR CTGCAAACAGGTGTGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr