ID: 1150941251

View in Genome Browser
Species Human (GRCh38)
Location 17:69696943-69696965
Sequence CTCTGGATATTGAGAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150941245_1150941251 28 Left 1150941245 17:69696892-69696914 CCAAATGTTTCTACTCTTAAGGA No data
Right 1150941251 17:69696943-69696965 CTCTGGATATTGAGAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150941251 Original CRISPR CTCTGGATATTGAGAGCAGC AGG Intergenic
No off target data available for this crispr