ID: 1150942666

View in Genome Browser
Species Human (GRCh38)
Location 17:69710025-69710047
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150942662_1150942666 9 Left 1150942662 17:69709993-69710015 CCATTTGTCGTTTCGTTGGACTT No data
Right 1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150942666 Original CRISPR CTGTAATTTTTATGGGAAGA GGG Intergenic
No off target data available for this crispr