ID: 1150948478

View in Genome Browser
Species Human (GRCh38)
Location 17:69774892-69774914
Sequence AGATTCTACTTGAGCTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150948478_1150948480 -8 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948480 17:69774907-69774929 TAGAATCTCCAAATGGAGCCTGG No data
1150948478_1150948489 16 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948489 17:69774931-69774953 GCTCTGGTTGGTCTAGCCTGGGG No data
1150948478_1150948488 15 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948488 17:69774930-69774952 GGCTCTGGTTGGTCTAGCCTGGG No data
1150948478_1150948481 -7 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948481 17:69774908-69774930 AGAATCTCCAAATGGAGCCTGGG No data
1150948478_1150948482 -6 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948482 17:69774909-69774931 GAATCTCCAAATGGAGCCTGGGG No data
1150948478_1150948487 14 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948487 17:69774929-69774951 GGGCTCTGGTTGGTCTAGCCTGG No data
1150948478_1150948490 20 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948490 17:69774935-69774957 TGGTTGGTCTAGCCTGGGGTAGG No data
1150948478_1150948485 4 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948485 17:69774919-69774941 ATGGAGCCTGGGGCTCTGGTTGG No data
1150948478_1150948484 0 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948484 17:69774915-69774937 CCAAATGGAGCCTGGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150948478 Original CRISPR AGATTCTACTTGAGCTTTTG AGG (reversed) Intergenic
No off target data available for this crispr