ID: 1150948480

View in Genome Browser
Species Human (GRCh38)
Location 17:69774907-69774929
Sequence TAGAATCTCCAAATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150948478_1150948480 -8 Left 1150948478 17:69774892-69774914 CCTCAAAAGCTCAAGTAGAATCT No data
Right 1150948480 17:69774907-69774929 TAGAATCTCCAAATGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150948480 Original CRISPR TAGAATCTCCAAATGGAGCC TGG Intergenic
No off target data available for this crispr