ID: 1150951919

View in Genome Browser
Species Human (GRCh38)
Location 17:69812570-69812592
Sequence TTGGTTAAACAAACCCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150951915_1150951919 5 Left 1150951915 17:69812542-69812564 CCAAGAATCTTCATAAATATTCC No data
Right 1150951919 17:69812570-69812592 TTGGTTAAACAAACCCATAAAGG No data
1150951913_1150951919 26 Left 1150951913 17:69812521-69812543 CCAAGAAATCTTTACCTTTTTCC No data
Right 1150951919 17:69812570-69812592 TTGGTTAAACAAACCCATAAAGG No data
1150951914_1150951919 12 Left 1150951914 17:69812535-69812557 CCTTTTTCCAAGAATCTTCATAA No data
Right 1150951919 17:69812570-69812592 TTGGTTAAACAAACCCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150951919 Original CRISPR TTGGTTAAACAAACCCATAA AGG Intergenic
No off target data available for this crispr