ID: 1150952437

View in Genome Browser
Species Human (GRCh38)
Location 17:69818775-69818797
Sequence TCGGTAAGGTATCTGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150952437_1150952443 4 Left 1150952437 17:69818775-69818797 CCTGACTCCAGATACCTTACCGA No data
Right 1150952443 17:69818802-69818824 GTGAACCCTATTGACTTGGGAGG No data
1150952437_1150952442 1 Left 1150952437 17:69818775-69818797 CCTGACTCCAGATACCTTACCGA No data
Right 1150952442 17:69818799-69818821 CGAGTGAACCCTATTGACTTGGG No data
1150952437_1150952447 25 Left 1150952437 17:69818775-69818797 CCTGACTCCAGATACCTTACCGA No data
Right 1150952447 17:69818823-69818845 GGATCCTGCAATTCTAGAGGTGG No data
1150952437_1150952446 22 Left 1150952437 17:69818775-69818797 CCTGACTCCAGATACCTTACCGA No data
Right 1150952446 17:69818820-69818842 GGAGGATCCTGCAATTCTAGAGG No data
1150952437_1150952441 0 Left 1150952437 17:69818775-69818797 CCTGACTCCAGATACCTTACCGA No data
Right 1150952441 17:69818798-69818820 GCGAGTGAACCCTATTGACTTGG No data
1150952437_1150952448 26 Left 1150952437 17:69818775-69818797 CCTGACTCCAGATACCTTACCGA No data
Right 1150952448 17:69818824-69818846 GATCCTGCAATTCTAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150952437 Original CRISPR TCGGTAAGGTATCTGGAGTC AGG (reversed) Intergenic