ID: 1150952443

View in Genome Browser
Species Human (GRCh38)
Location 17:69818802-69818824
Sequence GTGAACCCTATTGACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150952438_1150952443 -3 Left 1150952438 17:69818782-69818804 CCAGATACCTTACCGAGCGAGTG No data
Right 1150952443 17:69818802-69818824 GTGAACCCTATTGACTTGGGAGG No data
1150952437_1150952443 4 Left 1150952437 17:69818775-69818797 CCTGACTCCAGATACCTTACCGA No data
Right 1150952443 17:69818802-69818824 GTGAACCCTATTGACTTGGGAGG No data
1150952439_1150952443 -10 Left 1150952439 17:69818789-69818811 CCTTACCGAGCGAGTGAACCCTA No data
Right 1150952443 17:69818802-69818824 GTGAACCCTATTGACTTGGGAGG No data
1150952436_1150952443 13 Left 1150952436 17:69818766-69818788 CCTGTGTGTCCTGACTCCAGATA No data
Right 1150952443 17:69818802-69818824 GTGAACCCTATTGACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150952443 Original CRISPR GTGAACCCTATTGACTTGGG AGG Intergenic
No off target data available for this crispr