ID: 1150965552

View in Genome Browser
Species Human (GRCh38)
Location 17:69963937-69963959
Sequence TTGTTAAAGAGTAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150965552_1150965556 20 Left 1150965552 17:69963937-69963959 CCATCTTCCTTACTCTTTAACAA No data
Right 1150965556 17:69963980-69964002 AAAGCATGGTTCTGAAACATTGG No data
1150965552_1150965557 24 Left 1150965552 17:69963937-69963959 CCATCTTCCTTACTCTTTAACAA No data
Right 1150965557 17:69963984-69964006 CATGGTTCTGAAACATTGGAAGG No data
1150965552_1150965555 6 Left 1150965552 17:69963937-69963959 CCATCTTCCTTACTCTTTAACAA No data
Right 1150965555 17:69963966-69963988 ATCTAAAATCAGAGAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150965552 Original CRISPR TTGTTAAAGAGTAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr