ID: 1150965938

View in Genome Browser
Species Human (GRCh38)
Location 17:69968371-69968393
Sequence GTGTAAAATCTAATGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150965934_1150965938 -7 Left 1150965934 17:69968355-69968377 CCTGACAATGGATGGTGTGTAAA No data
Right 1150965938 17:69968371-69968393 GTGTAAAATCTAATGGTGGTGGG No data
1150965933_1150965938 -6 Left 1150965933 17:69968354-69968376 CCCTGACAATGGATGGTGTGTAA No data
Right 1150965938 17:69968371-69968393 GTGTAAAATCTAATGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150965938 Original CRISPR GTGTAAAATCTAATGGTGGT GGG Intergenic
No off target data available for this crispr