ID: 1150966917

View in Genome Browser
Species Human (GRCh38)
Location 17:69981300-69981322
Sequence CCTCACCCGGAGAAGTAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150966908_1150966917 17 Left 1150966908 17:69981260-69981282 CCATGATATAGATATATTGATCA 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1150966917 17:69981300-69981322 CCTCACCCGGAGAAGTAGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 347
1150966907_1150966917 21 Left 1150966907 17:69981256-69981278 CCTTCCATGATATAGATATATTG 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1150966917 17:69981300-69981322 CCTCACCCGGAGAAGTAGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150966917 Original CRISPR CCTCACCCGGAGAAGTAGTT GGG Intergenic
903752723 1:25637037-25637059 CCTCAGCCGGCCAAGTAGCTGGG - Intronic
904110140 1:28119553-28119575 CCTCAGCCTCAGAAGTAGCTGGG - Intergenic
904576001 1:31505449-31505471 CCTCAGCCGGAGGAGCAGTCCGG - Intergenic
904666286 1:32124255-32124277 CTTCACCCTCAAAAGTAGTTGGG - Intronic
905131561 1:35763908-35763930 CCTCACCCTCCCAAGTAGTTGGG + Intronic
905415605 1:37801731-37801753 CCTCAGCCTCAGAAGTAGCTGGG - Intergenic
905700406 1:40008721-40008743 CCTCAGCCGCCGCAGTAGTTAGG - Intergenic
907466225 1:54639325-54639347 CCTCACCCTCCCAAGTAGTTGGG - Intergenic
910922114 1:92359433-92359455 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
912477501 1:109949090-109949112 CCTCAGCCCCAGAAGTAGCTGGG - Intergenic
912922491 1:113882822-113882844 CCTCAGCCTCATAAGTAGTTGGG - Intronic
913395191 1:118362192-118362214 CCTCACCCTCAGTAGTAGCTGGG + Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917125221 1:171681296-171681318 CCTCAGCCTGACAAGTAGCTGGG + Intergenic
917326552 1:173838849-173838871 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
918894190 1:190318504-190318526 CATTACCCTGAGAAGCAGTTTGG - Intronic
919686686 1:200489425-200489447 CCTCAGCCCCTGAAGTAGTTGGG + Intergenic
921205230 1:212842979-212843001 CCTCACCCTCACAAGTAGCTGGG - Intronic
921569800 1:216764611-216764633 CCTCAGCCTGACAAGTAGATGGG + Intronic
921676884 1:217986233-217986255 CCTCAGCCTGTCAAGTAGTTGGG + Intergenic
922293939 1:224232473-224232495 CCTCACCCTCCCAAGTAGTTAGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1062781608 10:215671-215693 CCTCACCCTCCGAAGTAGCTGGG + Intronic
1063411259 10:5838373-5838395 CCTCAGCCCCACAAGTAGTTGGG - Intronic
1064629167 10:17291917-17291939 CCTCAGCCTCACAAGTAGTTGGG - Intergenic
1064643475 10:17437273-17437295 CCTCAACCTGCCAAGTAGTTGGG + Intronic
1065119835 10:22517441-22517463 CCTCAGCCTCACAAGTAGTTAGG - Intergenic
1065899418 10:30191786-30191808 CCTCAGCCTCACAAGTAGTTGGG + Intergenic
1066374643 10:34846717-34846739 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
1068295612 10:55069011-55069033 CCTCACCCTCCGAAGTAGCTGGG + Intronic
1069021227 10:63490529-63490551 CCTCAGCCTGACAAGTAGCTGGG + Intergenic
1069541153 10:69294911-69294933 CCTCACCCTCCCAAGTAGTTGGG - Intronic
1071945323 10:90637520-90637542 TCTCACCTGAAGAAGTTGTTGGG - Intergenic
1072154002 10:92707258-92707280 CCTCAGCCTCCGAAGTAGTTGGG - Intergenic
1072198626 10:93138884-93138906 CCTCAACCTCTGAAGTAGTTGGG + Intergenic
1072466947 10:95672806-95672828 CCTCAGCCTCTGAAGTAGTTGGG + Intronic
1073214325 10:101828303-101828325 CCAAACCCAGAGAAGGAGTTGGG - Intronic
1073727539 10:106251474-106251496 CCTCAACCGCAGATGGAGTTAGG - Intergenic
1074036522 10:109744880-109744902 CCTCACATGGAGAAGAACTTGGG - Intergenic
1074426125 10:113353064-113353086 CCTCACCCTGCCAAGTAGCTGGG - Intergenic
1074518894 10:114198767-114198789 CCTCAGCCTCAGAAGTAGCTGGG + Intronic
1074605406 10:114959018-114959040 CCTCACCCTGTGGAGTAGCTGGG - Intronic
1075173081 10:120133990-120134012 CCTCAGCCTCACAAGTAGTTGGG + Intergenic
1075695853 10:124434603-124434625 CCTCAGCCTCAGAAGTAGCTGGG - Intergenic
1076387050 10:130064862-130064884 CTTCACCCGCAGAAGTAACTGGG + Intergenic
1076518683 10:131065380-131065402 CCTCAGCCACAGAAGTAGCTTGG - Intergenic
1078475710 11:11627941-11627963 CCTCACCCCCACAAGTAGCTGGG + Intergenic
1085554619 11:77409154-77409176 CCTCAACCTCTGAAGTAGTTGGG - Intronic
1086105963 11:83147674-83147696 CCTCAGCCTGCCAAGTAGTTGGG - Intergenic
1086784557 11:90951222-90951244 CCTCAGCCTCCGAAGTAGTTGGG - Intergenic
1089223649 11:116896909-116896931 CCTCAGCCTCACAAGTAGTTGGG - Intronic
1090761881 11:129844569-129844591 CCTCAGCCTCATAAGTAGTTAGG - Intronic
1091525503 12:1296210-1296232 CCTCACCCTCCCAAGTAGTTGGG - Intronic
1094005026 12:25740277-25740299 CCTCACCCTTATAAGTAGCTGGG + Intergenic
1095889407 12:47221985-47222007 CCTCAGCCTGCCAAGTAGTTGGG - Intronic
1096169473 12:49455735-49455757 CCTCACCCGCCTAAGTAGCTGGG + Intronic
1096437290 12:51604641-51604663 CCTCAGCCTCAGAAGTAGCTGGG + Intronic
1096566176 12:52481420-52481442 CCTCAGCCACACAAGTAGTTGGG - Intergenic
1097025085 12:56049171-56049193 CCTCAGCCGCACAAGTAGCTGGG - Intergenic
1097849288 12:64395515-64395537 CCTCAGCCGCACAAGTAGCTGGG + Intergenic
1097853565 12:64437862-64437884 CCTCAGCCTGCCAAGTAGTTGGG - Intronic
1099532626 12:83803523-83803545 CCTCAGCCTGAGGAGTAGCTGGG - Intergenic
1100191324 12:92195125-92195147 CCTCATCCTGACAAGTAGCTGGG - Intergenic
1100464114 12:94830246-94830268 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
1101116944 12:101541267-101541289 CCTCAGCCTGCCAAGTAGTTGGG + Intergenic
1101230587 12:102737227-102737249 CCTCAGCCCGACAAGTAGCTGGG + Intergenic
1101397847 12:104364038-104364060 CCTCAGCCTCCGAAGTAGTTGGG - Intergenic
1102052595 12:109873691-109873713 CCTCAGCCTCATAAGTAGTTGGG - Intronic
1102060819 12:109929458-109929480 CCTCAGCCTCAGAAGTAGCTGGG - Intronic
1102158836 12:110752333-110752355 CCTCAGCCGCCCAAGTAGTTGGG + Intergenic
1102229386 12:111252068-111252090 CCTCAGCCTCACAAGTAGTTGGG - Intronic
1103824195 12:123723045-123723067 CCTCACCCTGTGAAGTAGGCTGG + Intronic
1103890677 12:124236788-124236810 GCTCACCCAGAGAGGAAGTTGGG + Intronic
1105405136 13:20127382-20127404 CCTCACCCTCACTAGTAGTTGGG + Intergenic
1106428746 13:29659042-29659064 CCTCACCTGGAGAATTATTTTGG + Intergenic
1107234775 13:38155038-38155060 CCTCACCCTCCGAAGTAGCTGGG + Intergenic
1108105723 13:47006586-47006608 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
1109599971 13:64612746-64612768 CTTCAGCCTGAGAAGTAGCTGGG + Intergenic
1110107207 13:71692636-71692658 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
1113681470 13:112247865-112247887 CAGCACCCGGAGAGGTGGTTTGG + Intergenic
1114682850 14:24501457-24501479 CCTTACCCAGAGATGTAGTTGGG - Intergenic
1115548875 14:34487687-34487709 CCTCACCCTTCCAAGTAGTTGGG + Intergenic
1115827254 14:37292039-37292061 CCTCACCCTGCTAAGTAGCTGGG + Intronic
1116172638 14:41422751-41422773 CCTCACCCTCCCAAGTAGTTGGG + Intergenic
1117236813 14:53786620-53786642 CCTCAGCCTGCCAAGTAGTTGGG - Intergenic
1118187027 14:63546857-63546879 CCTCAGCCTGTGGAGTAGTTGGG - Intergenic
1118970529 14:70633116-70633138 CCTCAGCCTCACAAGTAGTTGGG - Intergenic
1119297867 14:73547768-73547790 CCTCAGCCTGCCAAGTAGTTGGG - Intronic
1121044353 14:90777122-90777144 CCTCAGCCTCACAAGTAGTTGGG - Intronic
1122292948 14:100689194-100689216 GCTCACCTGGGGAAGTGGTTGGG + Intergenic
1122567539 14:102671509-102671531 CCTCACCCTCTGAAGTAGCTGGG + Intronic
1202842858 14_GL000009v2_random:139340-139362 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
1202912256 14_GL000194v1_random:129588-129610 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
1123880276 15:24672559-24672581 CCTCACCCAGTGAAGTAGCTGGG + Intergenic
1124120473 15:26884071-26884093 CCTCAGCCTGCCAAGTAGTTAGG - Intronic
1125018498 15:34961492-34961514 CCTCAGCCTCCGAAGTAGTTGGG - Intronic
1128034795 15:64515443-64515465 CCTCTCCCTGGGAAGCAGTTTGG + Intronic
1128162145 15:65430412-65430434 CCTCACCCTCACAAGTAGCTGGG + Intergenic
1130146422 15:81277557-81277579 CCTCAGCCTCTGAAGTAGTTGGG + Intronic
1130969895 15:88724116-88724138 CCTCAGCCTTACAAGTAGTTGGG - Intergenic
1131173574 15:90195723-90195745 CCTCACCCCCCGAAGTAGCTGGG + Intronic
1132120783 15:99173468-99173490 CCTCAGCCTGCGAAGTAGGTGGG - Intronic
1133042587 16:3068419-3068441 CCTCAGCCTGACAAGTAGTTGGG + Intronic
1133879986 16:9772485-9772507 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
1135713208 16:24736047-24736069 CCTCACCCTCACAAGTAGCTGGG - Intronic
1136412349 16:30084839-30084861 GCTCACCGGTAGCAGTAGTTGGG - Exonic
1136866107 16:33756110-33756132 CCTCAGCCGTTGGAGTAGTTGGG - Intergenic
1137443543 16:48516671-48516693 CCTCACCCTCCGAAGTAGCTGGG - Intergenic
1137814607 16:51386545-51386567 CCTTGCTGGGAGAAGTAGTTTGG + Intergenic
1138841671 16:60516197-60516219 CCTCACCCTCCCAAGTAGTTGGG - Intergenic
1139094793 16:63692531-63692553 CCTCACCCTGACAAGTAGCTGGG + Intergenic
1140477786 16:75247585-75247607 CCTGACCCAGAGAAGGAGTTTGG - Intronic
1141451278 16:84104984-84105006 CCTCACCCTCCGGAGTAGTTGGG - Intronic
1141677929 16:85527384-85527406 CCTCTCCCAGAGAAGAAGCTGGG + Intergenic
1203106046 16_KI270728v1_random:1359993-1360015 CCTCAGCCGTTGGAGTAGTTGGG + Intergenic
1203127468 16_KI270728v1_random:1602375-1602397 CCTCAGCCGTTGGAGTAGTTGGG - Intergenic
1142718463 17:1761061-1761083 CCTCACCCTGCTGAGTAGTTGGG - Intergenic
1143077336 17:4355524-4355546 CCTCAGCCTCAGAAGTAGCTGGG - Intronic
1143119343 17:4597373-4597395 CCCCACCTGGGGAAGAAGTTGGG - Intronic
1143319434 17:6058548-6058570 CCTCACCCTCCCAAGTAGTTGGG - Intronic
1144617307 17:16788299-16788321 CCTCAGCCTGCCAAGTAGTTGGG - Intronic
1144870585 17:18367767-18367789 CCTCAGCCTGAGGAGTAGCTGGG + Intergenic
1144895395 17:18527375-18527397 CCTCAGCCTGCCAAGTAGTTGGG + Intergenic
1145136824 17:20416854-20416876 CCTCAGCCTGCCAAGTAGTTGGG - Intergenic
1145895918 17:28457731-28457753 CCTCACCCTCCCAAGTAGTTGGG - Intronic
1145967469 17:28930197-28930219 GCTTACCAGGTGAAGTAGTTAGG - Intronic
1146046695 17:29514473-29514495 CCTCACCCTCCCAAGTAGTTGGG + Intronic
1146388445 17:32398617-32398639 CCTCACACAGACAAGTAGTTGGG + Intergenic
1146783586 17:35698423-35698445 CCTCAACCTGACCAGTAGTTGGG + Intronic
1147037369 17:37691810-37691832 CCTCACCCAGTGAAGAAGCTGGG + Intronic
1147284133 17:39387691-39387713 CCTCACCCTCCCAAGTAGTTGGG + Intronic
1147412145 17:40261411-40261433 CCTCAGCCTGCCAAGTAGTTGGG + Intronic
1147876045 17:43621411-43621433 CCTCAGCCTCAGAAGTAGTTGGG + Intergenic
1148176338 17:45569002-45569024 CCTCAGCCTCCGAAGTAGTTAGG - Intergenic
1148295036 17:46493958-46493980 CCTCAGCCTCCGAAGTAGTTAGG + Intergenic
1149141955 17:53441843-53441865 CCTCAGCCTCTGAAGTAGTTGGG + Intergenic
1149614258 17:57985453-57985475 TCTCCCCCAGAGAAGAAGTTGGG - Intronic
1149870035 17:60172726-60172748 CCTCAGCCTGCCAAGTAGTTGGG - Intergenic
1150254431 17:63732677-63732699 CCTCACCCTCCCAAGTAGTTGGG - Intronic
1150407567 17:64915980-64916002 CCTCAGCCTCTGAAGTAGTTAGG - Intronic
1150659247 17:67061244-67061266 CCTCAGCCTCTGAAGTAGTTGGG - Intergenic
1150966917 17:69981300-69981322 CCTCACCCGGAGAAGTAGTTGGG + Intergenic
1151537342 17:74746337-74746359 CCTCAGCCGCCGAAGTAGCTGGG + Exonic
1151650528 17:75466032-75466054 CCTCAGCCTCACAAGTAGTTAGG + Intronic
1152601501 17:81264513-81264535 CCTCCCCCGGAGAAGTGATCAGG + Intronic
1152991644 18:368748-368770 CCTCAGCCTCAGAAGTAGCTGGG - Intronic
1153806113 18:8709306-8709328 CCTCATCCTGATAAGTAGCTGGG + Intronic
1155197987 18:23492943-23492965 CCTCACCCTCCGGAGTAGTTGGG - Intergenic
1155803744 18:30141128-30141150 CCTCAGCCTGACAAGTAGCTTGG + Intergenic
1156191682 18:34727678-34727700 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
1158086162 18:53654115-53654137 CCTCAGCCTCAGAAGTAGCTGGG + Intergenic
1159685855 18:71419026-71419048 CCTCACCCGCCCAAGTAGCTGGG + Intergenic
1160172140 18:76563652-76563674 CCTCAGCCTCCGAAGTAGTTGGG - Intergenic
1160475180 18:79177797-79177819 CCTGACCCAGAGAAGCAGCTTGG - Intronic
1161027620 19:2043856-2043878 CCTCAGCCTCACAAGTAGTTGGG - Intronic
1161616854 19:5275688-5275710 CCTCAGCCTGCCAAGTAGTTGGG - Intronic
1162477705 19:10911004-10911026 CCTCAGCCGGCCAAGTAGCTGGG + Intronic
1162838802 19:13340540-13340562 CCTCACCCTCCCAAGTAGTTGGG + Intronic
1162986064 19:14270911-14270933 CCTCACCCTCTGAAGTAGCTAGG + Intergenic
1163098214 19:15076458-15076480 CCTCAGCCGCCCAAGTAGTTGGG - Intergenic
1163811298 19:19433882-19433904 CCTCAACCTGAGAAGTAGCTGGG + Intronic
1163837924 19:19587118-19587140 CCTCACCCTCACAAGTAGCTGGG + Intronic
1165000040 19:32753451-32753473 CCTCACCCTCTCAAGTAGTTGGG + Intronic
1165808027 19:38593763-38593785 CCTCACCCTCACAAGTAGCTGGG - Intronic
1165971141 19:39631205-39631227 CCTCAGCCTCTGAAGTAGTTGGG - Intergenic
1165987137 19:39779200-39779222 CCTCACCCTCAGGAGTAGCTGGG + Intronic
1166564842 19:43757692-43757714 CCTCAGCCTGAGGAGTAGCTGGG + Intergenic
1166879089 19:45916161-45916183 CCTCAGCCTCACAAGTAGTTGGG + Intergenic
1167646122 19:50706041-50706063 CCTCAGCCCCACAAGTAGTTGGG - Intronic
1167682994 19:50936831-50936853 CCTCAGCCTCTGAAGTAGTTGGG + Intergenic
1168324671 19:55531861-55531883 CCTCAGCCGGCCAAGTAGCTGGG - Intronic
924959789 2:23950-23972 CCTCAGCAAGAGAAGGAGTTTGG - Intergenic
927736366 2:25526142-25526164 CCTGACCAGGAGAAGTATGTTGG - Intronic
928709801 2:33991046-33991068 CCTCAGCCGGCTGAGTAGTTGGG + Intergenic
930163343 2:48180047-48180069 CCTCAGCCTCTGAAGTAGTTGGG - Intergenic
930171020 2:48251872-48251894 CCTCAGCCACATAAGTAGTTGGG - Intergenic
932588401 2:73046561-73046583 CCTCACCCTCACAAGTAGCTGGG - Intronic
932767204 2:74478490-74478512 CCTCAGCCTCAGAAGTAGCTAGG + Intronic
932880547 2:75497733-75497755 CCTCAGCCCCAGAAGTAGCTGGG - Intronic
934276832 2:91580208-91580230 CCTCAGCCTTCGAAGTAGTTGGG + Intergenic
934315329 2:91913015-91913037 CCTCAACTGCACAAGTAGTTGGG - Intergenic
934509227 2:94923682-94923704 CCTCACCCTCTGAAGTAGCTGGG - Intergenic
934634624 2:95972992-95973014 CCTCAGCCGTTGGAGTAGTTGGG - Intronic
934728846 2:96643463-96643485 CCTCACCCTCCGAAGTAGCTGGG + Intergenic
934783421 2:96987258-96987280 CCTCAGCCTCTGAAGTAGTTGGG - Intronic
934799010 2:97132244-97132266 CCTCAGCCGTTGGAGTAGTTGGG + Intronic
934834427 2:97571226-97571248 CCTCAGCCGTTGGAGTAGTTGGG - Intronic
936594971 2:113839179-113839201 CCTCAGCCTGCTAAGTAGTTGGG + Intergenic
938321282 2:130366937-130366959 CCTCAGCCTGCCAAGTAGTTGGG + Intronic
939528107 2:143321809-143321831 CCTCAGCCTCAGAAGTAGCTGGG + Intronic
940044167 2:149391853-149391875 CCTCACCAGGACAAATGGTTTGG + Intronic
943003982 2:182366349-182366371 CCTCACCCATAAAGGTAGTTGGG - Intronic
943209146 2:184940331-184940353 CCTCACCCTCACAAGTAGCTGGG + Intergenic
944476167 2:200109098-200109120 CCTCACCCTCCCAAGTAGTTGGG + Intergenic
946323169 2:218965650-218965672 CCTCAGCCTGCCAAGTAGTTAGG - Intergenic
946399961 2:219463092-219463114 CCTCACCCTCATAAGTAGCTGGG - Intronic
946737025 2:222764266-222764288 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
947496150 2:230638771-230638793 CCTCACCCTCTCAAGTAGTTGGG - Intergenic
1168798778 20:630473-630495 CCTCAGCCGCCCAAGTAGTTGGG - Intergenic
1170852058 20:20013929-20013951 CCTCAGCCTGACAAGTAGCTGGG + Intergenic
1172086640 20:32389699-32389721 CCTCAGCCTCACAAGTAGTTGGG + Intronic
1172512384 20:35509518-35509540 CCTCACCTAGACGAGTAGTTTGG - Intronic
1172628756 20:36364293-36364315 CCTCAGCCTCAAAAGTAGTTGGG - Intronic
1172895554 20:38297339-38297361 CCTCAGCCTGTCAAGTAGTTGGG - Intronic
1173182652 20:40816367-40816389 CCTCACCCCCAGCTGTAGTTTGG + Intergenic
1173832552 20:46100631-46100653 CCTCAGCCTCAGAAGTAGCTGGG - Intergenic
1174601052 20:51725236-51725258 CCTCAGCCTCACAAGTAGTTGGG + Intronic
1176631611 21:9144261-9144283 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
1176641699 21:9310600-9310622 CCTCACCCTCCGAAGTAGCTGGG - Intergenic
1177451072 21:21267077-21267099 ACTCACCAGGGGAAGCAGTTGGG + Intronic
1177581617 21:23030569-23030591 CCTCAGCCGCCGAAGTAGCTGGG + Intergenic
1179965805 21:44804516-44804538 CCTCAGCCTGCCAAGTAGTTGGG - Intergenic
1180350715 22:11799956-11799978 CCTCACCCTCCGAAGTAGCTGGG - Intergenic
1180387495 22:12192126-12192148 CCTCACCCTCTGAAGTAGCTGGG + Intergenic
1182044898 22:27266749-27266771 CCTCAGCCTGCCAAGTAGTTGGG + Intergenic
1182067497 22:27441150-27441172 CCTAACCAGGAGAGGTAGCTTGG + Intergenic
1182232020 22:28845563-28845585 CCTCAGCCTGCGAAGTAGCTGGG + Intergenic
950034911 3:9878428-9878450 CCTCACCTGGAGAGGGACTTGGG + Exonic
950783732 3:15414804-15414826 CCTCAGCCTCTGAAGTAGTTGGG - Intronic
952390110 3:32872786-32872808 CCTCACCTGGAGATGAAGTGTGG + Intronic
953997903 3:47534991-47535013 CCTCACCCTCCCAAGTAGTTGGG + Intergenic
954061868 3:48074622-48074644 CCTCACCCTGATGAGTAGCTAGG + Intronic
954787349 3:53103713-53103735 CCTCACTTGGAGAAGTTATTAGG - Intronic
956453430 3:69396387-69396409 CCTCACCCTGCCAAGTAATTGGG - Intronic
957878581 3:86181225-86181247 CCTCACCCTGAGAAGAAAATAGG - Intergenic
958131657 3:89434331-89434353 CCTCAGCCTCACAAGTAGTTTGG + Intronic
958582266 3:96042387-96042409 CCTCAGCCTCACAAGTAGTTAGG + Intergenic
959009713 3:101061110-101061132 GGTCACCCGGATAAGTATTTGGG + Intergenic
959060983 3:101616162-101616184 CCTCACCCGCCCAAGTAGCTGGG + Intergenic
961318633 3:126057355-126057377 CCTCACCCAGAGAAGGAGAAGGG + Intronic
961870732 3:129985911-129985933 CCTCACACAGACATGTAGTTGGG - Intergenic
962569208 3:136694991-136695013 GATCACCCAGAGAAGTATTTTGG + Intronic
966035402 3:175407066-175407088 CCTCAGCCTCACAAGTAGTTGGG - Intronic
967251587 3:187545631-187545653 CCTCAGCCTGCGAAGTAGCTGGG + Intergenic
968021649 3:195396669-195396691 CCTCAGCCTGCCAAGTAGTTGGG - Intronic
968323841 3:197794887-197794909 CCTCACCCTCTCAAGTAGTTGGG - Intronic
1202745195 3_GL000221v1_random:94418-94440 CCTCACCCTCCGAAGTAGCTGGG + Intergenic
968854706 4:3111131-3111153 CCTCACCCTCCCAAGTAGTTGGG + Intronic
969033927 4:4236172-4236194 CCTCAGCCTTCGAAGTAGTTGGG - Exonic
972505042 4:39712979-39713001 CCTCAGCCTGCCAAGTAGTTGGG + Intronic
973321086 4:48810969-48810991 CCTCAGCCCTACAAGTAGTTGGG + Intronic
974788694 4:66657040-66657062 CCTCAGCCGCAGGAGTAGCTGGG - Intergenic
974822853 4:67089952-67089974 CCTCAGCCTCCGAAGTAGTTGGG - Intergenic
974833431 4:67216545-67216567 CCTCACCCTGGCAAGTAGCTGGG - Intergenic
976235163 4:82889429-82889451 CCTCAGCCTCAGAAGTAGCTAGG - Intronic
977099357 4:92790529-92790551 CCTCACCTGTCCAAGTAGTTGGG + Intronic
978250258 4:106622310-106622332 CCCAACCCAGAGAAGTTGTTGGG + Intergenic
978431053 4:108633890-108633912 CCTCACCCTCCCAAGTAGTTGGG + Intergenic
980030448 4:127823262-127823284 CCTCACCCTCATAAGTAGATGGG + Intronic
980305151 4:131051428-131051450 CCTCAGCCTCACAAGTAGTTAGG + Intergenic
980698044 4:136385679-136385701 CCTCATCCCCTGAAGTAGTTGGG - Intergenic
988481318 5:31633652-31633674 CCTCAGCCGCCCAAGTAGTTGGG - Intergenic
988877400 5:35462224-35462246 CCTCAGCCGCACAAGTAGCTGGG - Intergenic
989070862 5:37509944-37509966 CCTCACCCTCCCAAGTAGTTGGG - Intronic
989078407 5:37589141-37589163 CCTCAGCCTCACAAGTAGTTGGG + Intronic
990430972 5:55735696-55735718 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
990432267 5:55747436-55747458 CCTCAACCTGCCAAGTAGTTAGG - Intronic
991774716 5:70073687-70073709 CCTCAGCCCGACAAGTAGCTGGG + Intronic
991854009 5:70949112-70949134 CCTCAGCCCGACAAGTAGCTGGG + Intronic
992234451 5:74694852-74694874 CCTCACCCTCCCAAGTAGTTGGG - Intronic
992587375 5:78253849-78253871 CCTCACCCTCCCAAGTAGTTGGG - Intronic
993059673 5:83024321-83024343 CCTCACCCCCAGAAGTAACTAGG + Intergenic
993376699 5:87156950-87156972 CCTCACCCTCTGGAGTAGTTAGG - Intergenic
993687512 5:90958166-90958188 CCTCAGCCTCAGAAGTAGCTGGG - Intronic
994402653 5:99300883-99300905 CCTCAGCCTTTGAAGTAGTTGGG + Intergenic
995088172 5:108140159-108140181 CCTCATCCTGCCAAGTAGTTGGG + Intronic
996516510 5:124375749-124375771 CCTCAGCCCCACAAGTAGTTGGG + Intergenic
997996290 5:138589472-138589494 CCTCAGCCTGCCAAGTAGTTAGG + Intergenic
998822543 5:146069687-146069709 CCTCACCCCCACAAGTAGCTGGG + Intronic
1000094922 5:157963208-157963230 CCTCAGCCTCAGAAGTAGCTGGG + Intergenic
1000683653 5:164219748-164219770 CCTCAGCCTCACAAGTAGTTGGG - Intergenic
1002117302 5:176973029-176973051 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
1002282501 5:178140287-178140309 CCTCAGCCTCAGAAGTAGCTGGG + Intronic
1002970999 6:2019563-2019585 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
1003674016 6:8186212-8186234 CCTCAGCCTGAGGAGTAGCTGGG + Intergenic
1005508483 6:26491222-26491244 CCTCAGCCGCAGGAGTAGCTGGG - Intergenic
1005925124 6:30438059-30438081 CCTCAGCCTGCCAAGTAGTTGGG - Intergenic
1006329323 6:33378762-33378784 CCTCAGTCTGAGGAGTAGTTGGG - Intergenic
1006355353 6:33553258-33553280 CCTCAACCTGAGGAGTAGTTGGG + Intergenic
1006942805 6:37764027-37764049 CCTCAGCCTTAGAAGTAGTTAGG - Intergenic
1007477854 6:42130999-42131021 CCTCAGCCTCCGAAGTAGTTGGG + Intronic
1009018420 6:57927647-57927669 CCTCACCCTCCCAAGTAGTTGGG - Intergenic
1010078978 6:71835219-71835241 CCTCAACCTGATGAGTAGTTGGG + Intergenic
1010384368 6:75262229-75262251 CCTCACCCTCCTAAGTAGTTGGG - Intronic
1010431105 6:75779384-75779406 CCTCAGCCGCCCAAGTAGTTGGG - Intronic
1014618450 6:123634323-123634345 CCTCAGCATCAGAAGTAGTTAGG - Intronic
1015862751 6:137697741-137697763 CCTCACCCTGAGAAGTGGCAAGG - Intergenic
1016392948 6:143592923-143592945 CCTCACCCTCACAAGTAGCTGGG - Intronic
1016727555 6:147392615-147392637 CCTCAACCTGCCAAGTAGTTTGG + Intergenic
1016773886 6:147882462-147882484 CCTCAGCCGCCTAAGTAGTTGGG - Intergenic
1017960857 6:159219154-159219176 CCTCACCCTCCCAAGTAGTTAGG + Intronic
1018568008 6:165177734-165177756 CCTCAGCCTCTGAAGTAGTTGGG - Intergenic
1018866395 6:167749949-167749971 CCTCAGCCTGCCAAGTAGTTGGG + Intergenic
1019703792 7:2487979-2488001 CCTCACCTGGAGAAACAGTCTGG + Intergenic
1020031382 7:4935235-4935257 CCTCACCCTCTGAAGTAGCTGGG - Intronic
1020134424 7:5579069-5579091 CCTCAGCCTCAGGAGTAGTTGGG + Intergenic
1020375635 7:7482407-7482429 CCTCACCCTCCCAAGTAGTTGGG - Intronic
1020658836 7:10959093-10959115 TCTAACCTGGAGAAGAAGTTAGG + Intergenic
1020924889 7:14313197-14313219 CCTCACACAGATATGTAGTTGGG - Intronic
1022614267 7:31912569-31912591 CCTCAGCCTCTGAAGTAGTTAGG - Intronic
1023384824 7:39646175-39646197 CCTCAGCCTGCCAAGTAGTTAGG - Intronic
1023911400 7:44559422-44559444 CCTCAGCCTGCCAAGTAGTTGGG - Intergenic
1024945622 7:54805008-54805030 CCCCACCAAGAGTAGTAGTTTGG + Intergenic
1026580862 7:71615590-71615612 CCTCACCCTCCCAAGTAGTTGGG + Intronic
1027156584 7:75772539-75772561 CCTCACCCTCAGGAGTAGCTGGG - Intronic
1028543887 7:91976335-91976357 CCTCAGCCCGACAAGTAGCTGGG + Intronic
1028983239 7:96989847-96989869 CCTCAACTGGAAAAGGAGTTGGG + Intergenic
1029097045 7:98094829-98094851 CCTCAGCCTGACAAGTAGCTTGG + Intergenic
1029475413 7:100780556-100780578 CCTCACCCCCACAAGTAGCTGGG - Intronic
1032823191 7:135543667-135543689 CCTCAGCCTCTGAAGTAGTTGGG + Intergenic
1034735426 7:153425072-153425094 CCTCAGCCTCTGAAGTAGTTCGG - Intergenic
1036007128 8:4678293-4678315 CCTCACCCTCCCAAGTAGTTGGG - Intronic
1037402185 8:18504285-18504307 CCTCACCCTCCGAAGTAGCTGGG - Intergenic
1037493298 8:19416228-19416250 CCTCAGCCTGTGGAGTAGTTGGG + Intronic
1037550318 8:19964642-19964664 CCTCAGCCTGACAAGTAGCTGGG + Intronic
1037589462 8:20301003-20301025 CCTCACCCTCACAAGTAGCTGGG - Intronic
1037687758 8:21158241-21158263 CCTCAACCTGCCAAGTAGTTGGG + Intergenic
1038131182 8:24733261-24733283 CCTCAGCCTCACAAGTAGTTTGG - Intergenic
1039775601 8:40732959-40732981 CCTCACCCTGCCAAGTAGCTGGG + Intronic
1040463445 8:47672071-47672093 CCTCAGCCCCTGAAGTAGTTGGG + Intronic
1040620039 8:49081895-49081917 CCTCACCCTCTCAAGTAGTTGGG - Intergenic
1043051872 8:75394829-75394851 CCTCACCCTGCCAAGTAGCTGGG + Intergenic
1045726007 8:105174628-105174650 CCTCAGCCTGCCAAGTAGTTGGG + Intronic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1045956268 8:107911329-107911351 CCTAACCTGGAGAAGTAGCAGGG + Intronic
1045985506 8:108245351-108245373 CCTCAGCCCCAGAAGTAGCTGGG - Intronic
1046737813 8:117795679-117795701 CCTCACCCTGCTTAGTAGTTGGG - Exonic
1046840513 8:118851157-118851179 CCTCAGCCTGCGAAGTAGCTGGG + Intergenic
1046922547 8:119748006-119748028 CCTCACCCAGCCAAGTAGCTGGG - Intronic
1047502582 8:125453749-125453771 CCTCACCCTCCCAAGTAGTTGGG + Intergenic
1047657679 8:126996342-126996364 CCTCAGCCTCACAAGTAGTTAGG - Intergenic
1048622977 8:136154989-136155011 CCTCACCTCATGAAGTAGTTTGG - Intergenic
1049080211 8:140437077-140437099 CCTCACCCTCACAAGTAGCTGGG + Intronic
1049815509 8:144597332-144597354 CCCCACCCAGAGAAGACGTTGGG - Intronic
1049979959 9:894928-894950 CCTCAGCCTGTGAAGTAGCTGGG + Intronic
1050958350 9:11693835-11693857 CCTCAGCCTCAGAAGTAGGTGGG + Intergenic
1059232778 9:112736968-112736990 CCTCACCCTCCCAAGTAGTTGGG + Intergenic
1059486743 9:114633109-114633131 CCTCACCCTCCCAAGTAGTTGGG + Intronic
1059705133 9:116815687-116815709 CCTCAGCCTGCCAAGTAGTTGGG - Intronic
1060221685 9:121767477-121767499 CCTCACCCTGACATGCAGTTGGG - Intronic
1060387999 9:123251009-123251031 CCTCAGCCTCACAAGTAGTTAGG - Intronic
1060569147 9:124622098-124622120 CCTCAGCCTGCGAAGTAGCTGGG - Intronic
1061419623 9:130466266-130466288 CCACACCCAGAGAAGTGGGTGGG + Intronic
1203754441 Un_GL000218v1:111868-111890 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
1203713819 Un_KI270742v1:124369-124391 CCTCACCCTCCGAAGTAGCTGGG + Intergenic
1185768734 X:2748676-2748698 CCTCAGCCTGCCAAGTAGTTGGG + Intergenic
1186271217 X:7890430-7890452 CCTCAGCCTCAGAAGTAGCTGGG - Intergenic
1187386474 X:18853207-18853229 CCTCAGCCGCCCAAGTAGTTGGG + Intergenic
1191645259 X:63473098-63473120 CCTCAGCCAGCCAAGTAGTTGGG - Intergenic
1193978074 X:88148340-88148362 CATCACCCGGTGAAGAACTTTGG + Intergenic
1194198916 X:90931563-90931585 CCTCACCCGCCCAAGTAGCTGGG - Intergenic
1194844951 X:98794052-98794074 CCTCACCCCCAAAAGTAGCTTGG + Intergenic
1195324314 X:103745916-103745938 CCTCAGCCTCCGAAGTAGTTAGG - Intergenic
1196280369 X:113817196-113817218 CCTCACCCTCTCAAGTAGTTAGG + Intergenic
1196526790 X:116737595-116737617 CCTCACCCTCCCAAGTAGTTGGG + Intergenic
1200544911 Y:4507983-4508005 CCTCACCCGCCCAAGTAGCTGGG - Intergenic
1201168074 Y:11229513-11229535 CCTCAGCCTCCGAAGTAGTTGGG + Intergenic
1201585835 Y:15560177-15560199 CCTCAGCCGGCTGAGTAGTTGGG - Intergenic
1202585876 Y:26426484-26426506 CCTCAGCCGTTGGAGTAGTTGGG + Intergenic